Transcript: Mouse NM_198642.2

Mus musculus RUN and cysteine rich domain containing beclin 1 interacting protein like (Rubcnl), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Rubcnl (271221)
Length:
2651
CDS:
173..2200

Additional Resources:

NCBI RefSeq record:
NM_198642.2
NBCI Gene record:
Rubcnl (271221)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198642.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215764 GTTAGAACTTGGGAAATATAA pLKO.1 1132 CDS 100% 15.000 21.000 N Rubcnl n/a
2 TRCN0000200804 GTACGCATTTAATGCTTTCAA pLKO.1 2324 3UTR 100% 5.625 7.875 N Rubcnl n/a
3 TRCN0000440984 CATAGCCCGGAGACAACATTT pLKO_005 2152 CDS 100% 13.200 10.560 N Rubcnl n/a
4 TRCN0000201390 GCCCTCTTGTACGCATTTAAT pLKO.1 2316 3UTR 100% 15.000 10.500 N Rubcnl n/a
5 TRCN0000429335 GAAGTACCAAGTCAGCGATTT pLKO_005 1657 CDS 100% 10.800 7.560 N Rubcnl n/a
6 TRCN0000191630 GCAGACATCATTATCTCAGTA pLKO.1 854 CDS 100% 4.950 3.465 N Rubcnl n/a
7 TRCN0000201045 CCTCTCATGATGTTACCACAT pLKO.1 2221 3UTR 100% 4.050 2.835 N Rubcnl n/a
8 TRCN0000192984 GCTTGGAATTTCTTCCCACTA pLKO.1 779 CDS 100% 4.050 2.835 N Rubcnl n/a
9 TRCN0000201453 CGGGAAGTCATGCTTAAGTCT pLKO.1 1385 CDS 100% 3.000 2.100 N Rubcnl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198642.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.