Transcript: Mouse NM_198653.2

Mus musculus isoleucine-tRNA synthetase 2, mitochondrial (Iars2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Iars2 (381314)
Length:
3540
CDS:
115..3153

Additional Resources:

NCBI RefSeq record:
NM_198653.2
NBCI Gene record:
Iars2 (381314)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198653.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102394 CCGATAAAGTGTCTCCTCTTT pLKO.1 1223 CDS 100% 4.950 6.930 N Iars2 n/a
2 TRCN0000102391 CCCGATAAAGTGTCTCCTCTT pLKO.1 1222 CDS 100% 4.050 5.670 N Iars2 n/a
3 TRCN0000102392 GCTGAGAGTATTCTACCAAAT pLKO.1 783 CDS 100% 10.800 7.560 N Iars2 n/a
4 TRCN0000102390 CCAAGGCTTACACAGAAAGTA pLKO.1 3240 3UTR 100% 5.625 3.938 N Iars2 n/a
5 TRCN0000102393 CGTGAAGAATATGTATGTCAT pLKO.1 2358 CDS 100% 4.950 3.465 N Iars2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198653.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.