Transcript: Mouse NM_198668.2

Mus musculus RIKEN cDNA 4930590J08 gene (4930590J08Rik), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
4930590J08Rik (381798)
Length:
3395
CDS:
509..3310

Additional Resources:

NCBI RefSeq record:
NM_198668.2
NBCI Gene record:
4930590J08Rik (381798)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198668.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200950 CCGACAGGACTCCATAATTAA pLKO.1 2320 CDS 100% 15.000 21.000 N 4930590J08Rik n/a
2 TRCN0000216539 GATGATACTGAGTCAACTAAA pLKO.1 3104 CDS 100% 13.200 18.480 N 4930590J08Rik n/a
3 TRCN0000265130 GATGATACTGAGTCAACTAAA pLKO_005 3104 CDS 100% 13.200 18.480 N 4930590J08Rik n/a
4 TRCN0000192130 CCTTAGAATATCCCAACCCAA pLKO.1 2193 CDS 100% 2.640 3.696 N 4930590J08Rik n/a
5 TRCN0000265128 TAGAGGCCGAAAGGATCTTAT pLKO_005 1386 CDS 100% 13.200 10.560 N 4930590J08Rik n/a
6 TRCN0000283290 AGCCCGACAGGACTCCATAAT pLKO_005 2317 CDS 100% 13.200 9.240 N 4930590J08Rik n/a
7 TRCN0000265129 TTTACTATCCCTCGGGAAATA pLKO_005 1653 CDS 100% 13.200 9.240 N 4930590J08Rik n/a
8 TRCN0000192309 CCATGAATGAGACGGTAACAA pLKO.1 1989 CDS 100% 5.625 3.938 N 4930590J08Rik n/a
9 TRCN0000165217 GCTGAGATCAAGAAGCGGTTT pLKO.1 2117 CDS 100% 4.050 2.835 N C3orf20 n/a
10 TRCN0000283288 CCAACCAAGTGCTGGTATTTG pLKO_005 2607 CDS 100% 13.200 7.920 N 4930590J08Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198668.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.