Transcript: Human NM_198793.2

Homo sapiens CD47 molecule (CD47), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
CD47 (961)
Length:
5288
CDS:
181..1098

Additional Resources:

NCBI RefSeq record:
NM_198793.2
NBCI Gene record:
CD47 (961)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198793.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293517 TCCGATTTGGAGAGTAGTAAG pLKO_005 1114 3UTR 100% 10.800 15.120 N CD47 n/a
2 TRCN0000007837 GCCTTGGTTTAATTGTGACTT pLKO.1 806 CDS 100% 4.950 3.960 N CD47 n/a
3 TRCN0000293515 GCCTTGGTTTAATTGTGACTT pLKO_005 806 CDS 100% 4.950 3.960 N CD47 n/a
4 TRCN0000293446 GATCAGCTCAGCTACTATTTA pLKO_005 227 CDS 100% 15.000 10.500 N CD47 n/a
5 TRCN0000007836 GCTTCCAATCAGAAGACTATA pLKO.1 1057 CDS 100% 13.200 9.240 N CD47 n/a
6 TRCN0000293516 GCTTCCAATCAGAAGACTATA pLKO_005 1057 CDS 100% 13.200 9.240 N CD47 n/a
7 TRCN0000007835 CCTGGTGATTACCCAGAGATA pLKO.1 1469 3UTR 100% 4.950 3.465 N CD47 n/a
8 TRCN0000007838 GTTACTAATATGGAGGCACAA pLKO.1 307 CDS 100% 4.050 2.835 N CD47 n/a
9 TRCN0000007839 GCACAATTACTTGGACTAGTT pLKO.1 1021 CDS 100% 0.000 0.000 N CD47 n/a
10 TRCN0000298514 GCACAATTACTTGGACTAGTT pLKO_005 1021 CDS 100% 0.000 0.000 N CD47 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198793.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13826 pDONR223 100% 99.8% 99% None 907delA n/a
Download CSV