Transcript: Mouse NM_198863.2

Mus musculus SLIT and NTRK-like family, member 2 (Slitrk2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Slitrk2 (245450)
Length:
7754
CDS:
257..2797

Additional Resources:

NCBI RefSeq record:
NM_198863.2
NBCI Gene record:
Slitrk2 (245450)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198863.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078785 CCTTGAACATATTGGAGGAAT pLKO.1 859 CDS 100% 4.950 6.930 N Slitrk2 n/a
2 TRCN0000078784 CCACCAACTTAGATGTAAGTT pLKO.1 2229 CDS 100% 0.563 0.788 N Slitrk2 n/a
3 TRCN0000078787 CCACACTTGCTTACACAATAA pLKO.1 2451 CDS 100% 13.200 10.560 N Slitrk2 n/a
4 TRCN0000078783 CCCAGTAATGTGTTTCGGTTT pLKO.1 776 CDS 100% 4.050 3.240 N Slitrk2 n/a
5 TRCN0000078786 CCAGCTCCTGTTTCTGAATAA pLKO.1 1678 CDS 100% 13.200 7.920 N Slitrk2 n/a
6 TRCN0000156913 GCCTCTGACCTTTGATGCTTT pLKO.1 1648 CDS 100% 4.950 2.970 N SLITRK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198863.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.