Transcript: Human NM_198889.3

Homo sapiens ankyrin repeat domain 17 (ANKRD17), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ANKRD17 (26057)
Length:
10044
CDS:
131..7189

Additional Resources:

NCBI RefSeq record:
NM_198889.3
NBCI Gene record:
ANKRD17 (26057)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198889.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016949 CCGATATAGAACTAGGGTGTT pLKO.1 1803 CDS 100% 4.050 5.670 N ANKRD17 n/a
2 TRCN0000274385 CCGATATAGAACTAGGGTGTT pLKO_005 1803 CDS 100% 4.050 5.670 N ANKRD17 n/a
3 TRCN0000274384 GAATAGAACCACAGCTAATAA pLKO_005 2098 CDS 100% 15.000 10.500 N ANKRD17 n/a
4 TRCN0000285198 TCTGAGCAAACACGGAAATTT pLKO_005 7503 3UTR 100% 15.000 10.500 N ANKRD17 n/a
5 TRCN0000304678 TCTGAGCAAACACGGAAATTT pLKO_005 7503 3UTR 100% 15.000 10.500 N Ankrd17 n/a
6 TRCN0000016948 GCACCCACAAATGCCACATAT pLKO.1 5444 CDS 100% 13.200 9.240 N ANKRD17 n/a
7 TRCN0000016951 GCTAGTATTGAGGACCATAAT pLKO.1 1202 CDS 100% 13.200 9.240 N ANKRD17 n/a
8 TRCN0000285199 GGTCAATGATGAAGGTTATAC pLKO_005 1615 CDS 100% 13.200 9.240 N ANKRD17 n/a
9 TRCN0000016952 GCAGCAGATAACCGCAAGATA pLKO.1 3518 CDS 100% 5.625 3.938 N ANKRD17 n/a
10 TRCN0000274424 GCAGCAGATAACCGCAAGATA pLKO_005 3518 CDS 100% 5.625 3.938 N ANKRD17 n/a
11 TRCN0000016950 GCTGCTAACTTTAACAGACAA pLKO.1 6467 CDS 100% 4.950 3.465 N ANKRD17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198889.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.