Transcript: Mouse NM_198894.2

Mus musculus active BCR-related gene (Abr), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Abr (109934)
Length:
5124
CDS:
311..2752

Additional Resources:

NCBI RefSeq record:
NM_198894.2
NBCI Gene record:
Abr (109934)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198894.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348195 GGTATGGGCACAGACAGATTG pLKO_005 3055 3UTR 100% 10.800 15.120 N Abr n/a
2 TRCN0000105835 GCTAAGTCTAAACAAGGGTTT pLKO.1 4306 3UTR 100% 4.050 5.670 N Abr n/a
3 TRCN0000374405 TTTCTCCCAGCACTCACTTTC pLKO_005 3089 3UTR 100% 10.800 7.560 N Abr n/a
4 TRCN0000105837 CCATCAGAAGTGGAGAGCAAA pLKO.1 2591 CDS 100% 4.950 3.465 N Abr n/a
5 TRCN0000334064 CCATCAGAAGTGGAGAGCAAA pLKO_005 2591 CDS 100% 4.950 3.465 N Abr n/a
6 TRCN0000105836 CCCATCAACAAGATGTCACTT pLKO.1 2531 CDS 100% 4.950 3.465 N Abr n/a
7 TRCN0000334063 CCCATCAACAAGATGTCACTT pLKO_005 2531 CDS 100% 4.950 3.465 N Abr n/a
8 TRCN0000105839 GAAGCGGAACACACTGTACTT pLKO.1 2716 CDS 100% 4.950 3.465 N Abr n/a
9 TRCN0000334065 GAAGCGGAACACACTGTACTT pLKO_005 2716 CDS 100% 4.950 3.465 N Abr n/a
10 TRCN0000105838 GCTCTGCTGTACAAGCCAATT pLKO.1 872 CDS 100% 10.800 6.480 N Abr n/a
11 TRCN0000363695 GCTCTGCTGTACAAGCCAATT pLKO_005 872 CDS 100% 10.800 6.480 N Abr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198894.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.