Transcript: Mouse NM_198937.2

Mus musculus hematological and neurological expressed 1-like (Hn1l), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Hn1l (52009)
Length:
2606
CDS:
13..585

Additional Resources:

NCBI RefSeq record:
NM_198937.2
NBCI Gene record:
Hn1l (52009)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198937.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072554 GCCTAATAGGATGGCATCTAA pLKO.1 129 CDS 100% 5.625 7.875 N JPT2 n/a
2 TRCN0000194537 GCCAAGTAACAGGTCTTACAT pLKO.1 2090 3UTR 100% 5.625 4.500 N Hn1l n/a
3 TRCN0000173398 GCTCCTATAATTGGGAGGAAA pLKO.1 1491 3UTR 100% 4.950 3.960 N Hn1l n/a
4 TRCN0000174476 CTAATAGGATGGCATCTAATA pLKO.1 131 CDS 100% 13.200 9.240 N Hn1l n/a
5 TRCN0000176186 GAAGTCCAGAAGAAGGTATTT pLKO.1 98 CDS 100% 13.200 9.240 N Hn1l n/a
6 TRCN0000194189 GTCCAGAAGAAGGTATTTCTT pLKO.1 101 CDS 100% 0.563 0.394 N Hn1l n/a
7 TRCN0000298453 ACATACCCAAGAGGACAAATC pLKO_005 179 CDS 100% 10.800 6.480 N JPT2 n/a
8 TRCN0000173982 GAGGAGAATCGAGCGATCTTT pLKO.1 74 CDS 100% 5.625 3.375 N Hn1l n/a
9 TRCN0000173674 CCTACAGTTGACAGTCATGAA pLKO.1 484 CDS 100% 4.950 2.970 N Hn1l n/a
10 TRCN0000175940 GTATTTCTTCAAGCAAGCCTA pLKO.1 113 CDS 100% 2.640 1.584 N Hn1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198937.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.