Transcript: Mouse NM_198958.2

Mus musculus NADPH oxidase 3 (Nox3), mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Nox3 (224480)
Length:
1792
CDS:
61..1767

Additional Resources:

NCBI RefSeq record:
NM_198958.2
NBCI Gene record:
Nox3 (224480)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198958.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420088 CTTATGCCCTGTACCTCAATT pLKO_005 819 CDS 100% 13.200 18.480 N Nox3 n/a
2 TRCN0000076593 GCACCTTTGATATGGGCACAA pLKO.1 533 CDS 100% 4.050 5.670 N Nox3 n/a
3 TRCN0000443443 ATCTGCCGTGTGCCTGAATTT pLKO_005 228 CDS 100% 13.200 10.560 N Nox3 n/a
4 TRCN0000431231 GATAGCTGTCAATTCAGTTAT pLKO_005 384 CDS 100% 13.200 10.560 N Nox3 n/a
5 TRCN0000437719 AGACTGGACAGAGGCGTTATT pLKO_005 1131 CDS 100% 13.200 9.240 N Nox3 n/a
6 TRCN0000413465 TTGTTCAACCTGGAGCGTTAT pLKO_005 421 CDS 100% 10.800 7.560 N Nox3 n/a
7 TRCN0000076594 CCAGGCAATTCACATAGCTTT pLKO.1 1512 CDS 100% 4.950 3.465 N Nox3 n/a
8 TRCN0000076595 CCTATCTGTTTATTGACACAT pLKO.1 131 CDS 100% 4.950 3.465 N Nox3 n/a
9 TRCN0000076597 CCTGGAACTTCACATGAAGAA pLKO.1 975 CDS 100% 4.950 3.465 N Nox3 n/a
10 TRCN0000076596 GCTCATTTACTGAGCTACCAT pLKO.1 1465 CDS 100% 0.300 0.210 N Nox3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198958.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.