Transcript: Human NM_198993.5

Homo sapiens SH3 and cysteine rich domain 2 (STAC2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
STAC2 (342667)
Length:
3430
CDS:
444..1679

Additional Resources:

NCBI RefSeq record:
NM_198993.5
NBCI Gene record:
STAC2 (342667)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198993.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245591 CTGATGAACCGCTCCAGTTTC pLKO_005 1089 CDS 100% 10.800 15.120 N STAC2 n/a
2 TRCN0000180288 CCTACGTTGCACTCTACAAGT pLKO.1 1330 CDS 100% 4.950 6.930 N STAC2 n/a
3 TRCN0000245589 TGGCTTCTTCCCAGCTAATTT pLKO_005 1457 CDS 100% 15.000 10.500 N STAC2 n/a
4 TRCN0000245590 ACCTCTGTCATTCCGTCAATT pLKO_005 2237 3UTR 100% 13.200 9.240 N STAC2 n/a
5 TRCN0000412476 ATGCTGGTGGATGACTCTAAC pLKO_005 1401 CDS 100% 10.800 7.560 N Stac2 n/a
6 TRCN0000245588 GACAGTGCATCTCCAGTATTC pLKO_005 1209 CDS 100% 10.800 7.560 N STAC2 n/a
7 TRCN0000148371 CTTGCGATGTAAGATGTGCAA pLKO.1 857 CDS 100% 2.640 1.848 N STAC2 n/a
8 TRCN0000105897 GAAACCAAGCTCCAGCGATTT pLKO.1 525 CDS 100% 10.800 15.120 N Stac2 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2406 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198993.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13605 pDONR223 100% 65.4% 65.4% None 1_426del n/a
2 ccsbBroad304_13605 pLX_304 0% 65.4% 65.4% V5 1_426del n/a
Download CSV