Transcript: Mouse NM_199007.2

Mus musculus shugoshin 2A (Sgo2a), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-10
Taxon:
Mus musculus (mouse)
Gene:
Sgo2a (68549)
Length:
5314
CDS:
342..3836

Additional Resources:

NCBI RefSeq record:
NM_199007.2
NBCI Gene record:
Sgo2a (68549)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_199007.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000452587 GATCTTTCCATCGAAGCTAAT pLKO_005 2007 CDS 100% 10.800 15.120 N Sgo2a n/a
2 TRCN0000072111 CGTGTGATTATAAGTCTGAAA pLKO.1 2599 CDS 100% 4.950 6.930 N Sgo2a n/a
3 TRCN0000072108 GCTCGTATCTATCTACTGATT pLKO.1 4776 3UTR 100% 4.950 6.930 N Sgo2a n/a
4 TRCN0000451355 CATCACATAACTTGTTGATTT pLKO_005 4068 3UTR 100% 13.200 10.560 N Sgo2a n/a
5 TRCN0000072112 CATCCTTACATCAGTGCAATT pLKO.1 931 CDS 100% 10.800 8.640 N Sgo2a n/a
6 TRCN0000439729 ATGTGCATGAAATAGCTATAT pLKO_005 4013 3UTR 100% 13.200 9.240 N Sgo2a n/a
7 TRCN0000451084 TATCAAAGATTGCGAAGATAT pLKO_005 2885 CDS 100% 13.200 9.240 N Sgo2a n/a
8 TRCN0000072109 GCAGGTAAGAAACTTAGACAA pLKO.1 2682 CDS 100% 4.950 3.465 N Sgo2a n/a
9 TRCN0000072110 GCAGAAGAACACCGATAGCTT pLKO.1 1355 CDS 100% 3.000 2.100 N Sgo2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199007.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.