Transcript: Mouse NM_199009.3

Mus musculus family with sequence similarity 160, member A2 (Fam160a2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Fam160a2 (74349)
Length:
10853
CDS:
366..3293

Additional Resources:

NCBI RefSeq record:
NM_199009.3
NBCI Gene record:
Fam160a2 (74349)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_199009.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201537 CGCCTTTCTTGTTGGATACTT pLKO.1 3220 CDS 100% 5.625 7.875 N Fam160a2 n/a
2 TRCN0000189466 CGGACTAAGAAACGCAGTCTA pLKO.1 2136 CDS 100% 4.950 6.930 N Fam160a2 n/a
3 TRCN0000200826 GCTGGTTGATTATATTCACAA pLKO.1 1328 CDS 100% 4.950 6.930 N Fam160a2 n/a
4 TRCN0000191895 GCTGAACAGTTGAAACTATTT pLKO.1 747 CDS 100% 13.200 10.560 N Fam160a2 n/a
5 TRCN0000129338 CCCTTGCACTCTTCATGAGTT pLKO.1 1252 CDS 100% 4.950 3.465 N FAM160A2 n/a
6 TRCN0000190132 CCTCGCCTTTCTTGTTGGATA pLKO.1 3217 CDS 100% 4.950 3.465 N Fam160a2 n/a
7 TRCN0000128043 GAACTCCGTCTATGTCAACTT pLKO.1 2639 CDS 100% 4.950 3.465 N FAM160A2 n/a
8 TRCN0000201374 GAAGACAATTACCTGGAGTAT pLKO.1 2007 CDS 100% 4.950 3.465 N Fam160a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199009.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.