Transcript: Mouse NM_199015.4

Mus musculus PHD finger protein 11D (Phf11d), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Phf11d (219132)
Length:
2696
CDS:
82..1044

Additional Resources:

NCBI RefSeq record:
NM_199015.4
NBCI Gene record:
Phf11d (219132)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_199015.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432471 AGACTCTTGATCTACGTAATA pLKO_005 275 CDS 100% 13.200 18.480 N Phf11d n/a
2 TRCN0000085884 GATGAAATGTAGTAACGCCAA pLKO.1 615 CDS 100% 2.160 1.728 N Phf11d n/a
3 TRCN0000426092 GAAACCATGGAACTTACAAAT pLKO_005 470 CDS 100% 13.200 9.240 N Phf11d n/a
4 TRCN0000421695 CAGAACATTCTCCAGAACAAG pLKO_005 500 CDS 100% 4.950 3.465 N Phf11d n/a
5 TRCN0000085887 GTGTGATTTATGGTTCTGTAA pLKO.1 393 CDS 100% 4.950 3.465 N Phf11d n/a
6 TRCN0000435940 ATGCTCATTCTGTAACAAAGG pLKO_005 357 CDS 100% 4.050 2.835 N Phf11d n/a
7 TRCN0000085885 CTGTAAGAAGAGTTACCACTA pLKO.1 408 CDS 100% 4.050 2.835 N Phf11d n/a
8 TRCN0000283913 CTACATAAGACTGTTCAATTG pLKO_005 2393 3UTR 100% 10.800 6.480 N Rbm8a2 n/a
9 TRCN0000367053 GAGCTTTGCTCAGCCTTAAAT pLKO_005 1147 3UTR 100% 15.000 7.500 Y Phf11b n/a
10 TRCN0000376129 CAAGAAGTAATCAAGAGTAAA pLKO_005 868 CDS 100% 13.200 6.600 Y Phf11b n/a
11 TRCN0000085883 CTCAGCCTTAAATGGAATCTT pLKO.1 1155 3UTR 100% 5.625 2.813 Y Phf11d n/a
12 TRCN0000085848 TCAGCCTTAAATGGAATCTTA pLKO.1 1156 3UTR 100% 5.625 2.813 Y Phf11a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199015.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.