Transcript: Mouse NM_199055.2

Mus musculus carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9 (Chst9), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Chst9 (71367)
Length:
1369
CDS:
40..1281

Additional Resources:

NCBI RefSeq record:
NM_199055.2
NBCI Gene record:
Chst9 (71367)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_199055.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103093 CGTCCAGTAGGAATGGATATT pLKO.1 973 CDS 100% 13.200 10.560 N Chst9 n/a
2 TRCN0000103094 TGCAAGAAATATGGTAGAGTA pLKO.1 505 CDS 100% 4.950 3.960 N Chst9 n/a
3 TRCN0000103092 GCGTTTGAATACATATACCAA pLKO.1 753 CDS 100% 3.000 2.400 N Chst9 n/a
4 TRCN0000103091 GCCGAAAGACAGCTCATCTAT pLKO.1 1207 CDS 100% 5.625 3.938 N Chst9 n/a
5 TRCN0000103090 GCAAGAAATATGGTAGAGTAA pLKO.1 506 CDS 100% 4.950 3.465 N Chst9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199055.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.