Transcript: Human NM_199181.2

Homo sapiens suppressor of glucose, autophagy associated 1 (SOGA1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-17
Taxon:
Homo sapiens (human)
Gene:
SOGA1 (140710)
Length:
3728
CDS:
328..3378

Additional Resources:

NCBI RefSeq record:
NM_199181.2
NBCI Gene record:
SOGA1 (140710)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_199181.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179997 CGCTCAGCATTCTGATAACAA pLKO.1 2478 CDS 100% 5.625 7.875 N SOGA1 n/a
2 TRCN0000156225 CAGTGAGAAGATCCACGACAA pLKO.1 3030 CDS 100% 4.050 5.670 N SOGA1 n/a
3 TRCN0000155326 GAGGAGATAAACGCTCAGCAT pLKO.1 2467 CDS 100% 2.640 2.112 N SOGA1 n/a
4 TRCN0000128211 CTTCCATGTCTGAGTTTGAAA pLKO.1 3110 CDS 100% 5.625 3.938 N SOGA1 n/a
5 TRCN0000155325 GAGATGGACGACATGAAGGAT pLKO.1 1042 CDS 100% 3.000 2.100 N SOGA1 n/a
6 TRCN0000155184 GCTGTTTCCGAAGTTGAGCTT pLKO.1 3055 CDS 100% 2.640 1.848 N SOGA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199181.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.