Transcript: Mouse NM_199252.2

Mus musculus unc-93 homolog A (C. elegans) (Unc93a), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Unc93a (381058)
Length:
2666
CDS:
296..1672

Additional Resources:

NCBI RefSeq record:
NM_199252.2
NBCI Gene record:
Unc93a (381058)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_199252.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126609 GCTCTGTCATTAAAGCACTTT pLKO.1 1985 3UTR 100% 4.950 3.465 N Unc93a n/a
2 TRCN0000271034 AGATGTGGTGAACCAGTATTT pLKO_005 688 CDS 100% 13.200 6.600 Y Gm9992 n/a
3 TRCN0000271037 CCACCTCTTTGGTCCACATTA pLKO_005 1013 CDS 100% 13.200 6.600 Y Gm9992 n/a
4 TRCN0000271035 GCCTTTGGCTACAGCTCATTT pLKO_005 1490 CDS 100% 13.200 6.600 Y Gm9992 n/a
5 TRCN0000271101 GGAGAGTACACAAAGTCTTAT pLKO_005 1124 CDS 100% 13.200 6.600 Y Gm9992 n/a
6 TRCN0000271036 TGTCAACCTTCATGCTGTTTA pLKO_005 1035 CDS 100% 13.200 6.600 Y Gm9992 n/a
7 TRCN0000126612 AGAAGCCATAGGGTTTGTCAT pLKO.1 1468 CDS 100% 4.950 2.475 Y Unc93a n/a
8 TRCN0000126613 GAGCAGCCATTCACTTCTCTT pLKO.1 1275 CDS 100% 4.950 2.475 Y Unc93a n/a
9 TRCN0000126610 CAGACACAGAACAATGCTCTT pLKO.1 1391 CDS 100% 4.050 2.025 Y Unc93a n/a
10 TRCN0000126611 GTGTGTGAGTACCAAGCTCTA pLKO.1 1513 CDS 100% 4.050 2.025 Y Unc93a n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2330 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199252.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.