Transcript: Human NM_199454.3

Homo sapiens PR/SET domain 16 (PRDM16), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-25
Taxon:
Homo sapiens (human)
Gene:
PRDM16 (63976)
Length:
8641
CDS:
58..3831

Additional Resources:

NCBI RefSeq record:
NM_199454.3
NBCI Gene record:
PRDM16 (63976)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_199454.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020048 GCACGGTGAAGCCTTTCATAT pLKO.1 1223 CDS 100% 13.200 18.480 N PRDM16 n/a
2 TRCN0000020045 CGGTGACGTTGTAAATAATAT pLKO.1 99 CDS 100% 15.000 12.000 N PRDM16 n/a
3 TRCN0000367875 ATTGACTGCAGAGTCTATTTA pLKO_005 4284 3UTR 100% 15.000 10.500 N PRDM16 n/a
4 TRCN0000358539 ACGAGAAAGAAGACTCTTATT pLKO_005 3254 CDS 100% 13.200 9.240 N PRDM16 n/a
5 TRCN0000367912 CCATTGCCGAGAAGTACTTTG pLKO_005 2150 CDS 100% 10.800 7.560 N PRDM16 n/a
6 TRCN0000020044 GCCAATAGTGAGATGAACCAA pLKO.1 3298 CDS 100% 3.000 2.100 N PRDM16 n/a
7 TRCN0000020047 CGCCCACAACTTGCTGGTCAA pLKO.1 2292 CDS 100% 1.350 0.945 N PRDM16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199454.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.