Transcript: Mouse NM_201354.2

Mus musculus CBP80/20-dependent translation initiation factor (Ctif), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ctif (269037)
Length:
6192
CDS:
332..2203

Additional Resources:

NCBI RefSeq record:
NM_201354.2
NBCI Gene record:
Ctif (269037)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_201354.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425291 ATCCTTAACAGCATGAGAAAT pLKO_005 1538 CDS 100% 13.200 18.480 N Ctif n/a
2 TRCN0000192783 CGCCAATACCTTTGATTCCTT pLKO.1 634 CDS 100% 3.000 4.200 N Ctif n/a
3 TRCN0000191120 GCTGGCAAATTACAACCAAAT pLKO.1 3311 3UTR 100% 10.800 8.640 N Ctif n/a
4 TRCN0000201391 GCTGTTCTATGGAGCTACAAA pLKO.1 1974 CDS 100% 5.625 4.500 N Ctif n/a
5 TRCN0000422745 AGGCTGAGATAAAGCATAAAG pLKO_005 1290 CDS 100% 13.200 9.240 N Ctif n/a
6 TRCN0000427383 GTATCAGCCTGAATGACATTG pLKO_005 795 CDS 100% 10.800 7.560 N Ctif n/a
7 TRCN0000202445 GCAGTACTACAACAGGACCAT pLKO.1 2164 CDS 100% 2.640 1.848 N Ctif n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_201354.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.