Transcript: Human NM_201589.4

Homo sapiens MAF bZIP transcription factor A (MAFA), mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
MAFA (389692)
Length:
2669
CDS:
327..1388

Additional Resources:

NCBI RefSeq record:
NM_201589.4
NBCI Gene record:
MAFA (389692)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_201589.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086315 CAACGACTTCGACCTGATGAA pLKO.1 389 CDS 100% 4.950 3.465 N Mafa n/a
2 TRCN0000016283 CCTGATGAAGTTCGAGGTGAA pLKO.1 401 CDS 100% 4.050 2.835 N MAFA n/a
3 TRCN0000086314 GCTGGAGGATCTGTACTGGAT pLKO.1 662 CDS 100% 2.640 1.848 N Mafa n/a
4 TRCN0000016286 CGGCTACCAGCATCACCTCAA pLKO.1 686 CDS 100% 1.350 0.945 N MAFA n/a
5 TRCN0000432698 AGGTCATCCGGCTCAAGCAGA pLKO_005 1078 CDS 100% 0.880 0.616 N MAFA n/a
6 TRCN0000016285 CGCCGCAGCCTACGAGGCTTT pLKO.1 803 CDS 100% 0.000 0.000 N MAFA n/a
7 TRCN0000016287 TCAACGACTTCGACCTGATGA pLKO.1 388 CDS 100% 4.950 2.970 N MAFA n/a
8 TRCN0000193799 CAAGGAGAAATACGAGAAGCT pLKO.1 1256 CDS 100% 2.640 1.320 Y Maf n/a
9 TRCN0000423501 CAAGGAGAAATACGAGAAGCT pLKO_005 1256 CDS 100% 2.640 1.320 Y MAFA n/a
10 TRCN0000000256 ACAAGGAGAAATACGAGAAGT pLKO.1 1255 CDS 100% 4.950 2.475 Y MAF n/a
11 TRCN0000000255 CAAGGAGAAATACGAGAAGTT pLKO.1 1256 CDS 100% 4.950 2.475 Y MAF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_201589.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.