Transcript: Human NM_203318.2

Homo sapiens myosin XVIIIA (MYO18A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
MYO18A (399687)
Length:
9935
CDS:
168..6287

Additional Resources:

NCBI RefSeq record:
NM_203318.2
NBCI Gene record:
MYO18A (399687)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_203318.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430773 GACATTGACTCCGATAGTAAC pLKO_005 405 CDS 100% 10.800 15.120 N MYO18A n/a
2 TRCN0000417584 GATCGACTGGTGGAGATTAAT pLKO_005 987 CDS 100% 15.000 10.500 N MYO18A n/a
3 TRCN0000424374 ATGACGTTGAGAAGGCTAATG pLKO_005 1348 CDS 100% 10.800 7.560 N MYO18A n/a
4 TRCN0000221049 GCTTCTGATGATGGCAGCTTA pLKO.1 6111 CDS 100% 4.950 3.465 N MYO18A n/a
5 TRCN0000221052 CGAATTGATGAAGAAGCACAA pLKO.1 5435 CDS 100% 4.050 2.835 N MYO18A n/a
6 TRCN0000221053 CGATGCACTGAAGAAGCAGAT pLKO.1 4166 CDS 100% 4.050 2.835 N MYO18A n/a
7 TRCN0000221050 GCTGAACTACACCAAGCAGAA pLKO.1 3002 CDS 100% 4.050 2.835 N MYO18A n/a
8 TRCN0000221051 CGGAAGGAGAAGAAGGAGAAA pLKO.1 210 CDS 100% 4.950 2.970 N MYO18A n/a
9 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 8768 3UTR 100% 10.800 5.400 Y MRPS16 n/a
10 TRCN0000440210 TTCTCTCCTGCAATTGGTTTG pLKO_005 7451 3UTR 100% 6.000 3.000 Y TIAF1 n/a
11 TRCN0000107203 CGGGTCCAGGTTCTTAAGAAT pLKO.1 6930 3UTR 100% 5.625 2.813 Y TIAF1 n/a
12 TRCN0000107201 CCTCTTTGTCTCAGCGTGTTA pLKO.1 7051 3UTR 100% 4.950 2.475 Y TIAF1 n/a
13 TRCN0000107202 GCAATGACCTATTTAAGGTAA pLKO.1 7075 3UTR 100% 4.950 2.475 Y TIAF1 n/a
14 TRCN0000442556 TGAGCAAGCCTACGCAGACAA pLKO_005 6989 3UTR 100% 4.950 2.475 Y TIAF1 n/a
15 TRCN0000107204 CCCATTCCAACTACAGCAGTT pLKO.1 7097 3UTR 100% 4.050 2.025 Y TIAF1 n/a
16 TRCN0000107200 CGGTGCTCATTAGACATGAGT pLKO.1 7245 3UTR 100% 0.300 0.150 Y TIAF1 n/a
17 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 8768 3UTR 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_203318.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.