Transcript: Mouse NM_205844.3

Mus musculus GDNF family receptor alpha like (Gfral), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Gfral (404194)
Length:
2080
CDS:
196..1377

Additional Resources:

NCBI RefSeq record:
NM_205844.3
NBCI Gene record:
Gfral (404194)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_205844.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000452875 CTTCATAGCAAATCGTGTTTC pLKO_005 1126 CDS 100% 10.800 15.120 N Gfral n/a
2 TRCN0000193464 GACTGGATTCAATTCTTTCTT pLKO.1 1215 CDS 100% 5.625 7.875 N Gfral n/a
3 TRCN0000129022 GCCATACGGTTCTTCTATCAA pLKO.1 703 CDS 100% 5.625 7.875 N GFRAL n/a
4 TRCN0000175060 GAATCTAACTACTACTCCTTT pLKO.1 537 CDS 100% 4.950 6.930 N Gfral n/a
5 TRCN0000194140 GTGATGCTCAAGTTAAGGATA pLKO.1 1297 CDS 100% 4.950 6.930 N Gfral n/a
6 TRCN0000442202 ATTTGCCAATAACGCAATTTA pLKO_005 1432 3UTR 100% 15.000 10.500 N Gfral n/a
7 TRCN0000129051 GTGACTGTGCTCAATCTGATA pLKO.1 761 CDS 100% 4.950 3.465 N GFRAL n/a
8 TRCN0000173427 GCCTCAGTGTAATTCACACTT pLKO.1 854 CDS 100% 0.495 0.347 N Gfral n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_205844.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.