Transcript: Human NM_206880.1

Homo sapiens olfactory receptor family 2 subfamily V member 2 (OR2V2), mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
OR2V2 (285659)
Length:
948
CDS:
1..948

Additional Resources:

NCBI RefSeq record:
NM_206880.1
NBCI Gene record:
OR2V2 (285659)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_206880.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000186406 CCTGTTTGAGAAGGTGATATT pLKO.1 582 CDS 100% 13.200 9.240 N OR2V2 n/a
2 TRCN0000204012 GATCCAGATGGTGGTAGTAAT pLKO.1 474 CDS 100% 13.200 9.240 N OR2V2 n/a
3 TRCN0000187659 GAGGAAGGTGAACCATTTCTT pLKO.1 516 CDS 100% 5.625 3.938 N OR2V2 n/a
4 TRCN0000203960 CTTCATGCTTCTCTTCCCATT pLKO.1 615 CDS 100% 4.050 2.835 N OR2V2 n/a
5 TRCN0000584810 GTGGGCTGTGGCATACAAATT pLKO_005 286 CDS 100% 13.200 6.600 Y n/a
6 TRCN0000204419 CCTCCTCATCTTCCTCATCTA pLKO.1 132 CDS 100% 4.950 2.475 Y OR2V2 n/a
7 TRCN0000583883 TCCTGGGCCTTTGGGATAATA pLKO_005 445 CDS 100% 15.000 7.500 Y n/a
8 TRCN0000060371 CCATGTACTTCTTCCTCAGAA pLKO.1 176 CDS 100% 4.950 2.475 Y OR10A2 n/a
9 TRCN0000188492 CCCATGTACTTCTTCCTCACA pLKO.1 175 CDS 100% 2.640 1.320 Y Olfr317 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_206880.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.