Transcript: Mouse NM_207151.1

Mus musculus olfactory receptor 1308 (Olfr1308), mRNA.

Source:
NCBI, updated 2013-04-17
Taxon:
Mus musculus (mouse)
Gene:
Olfr1308 (258258)
Length:
963
CDS:
1..963

Additional Resources:

NCBI RefSeq record:
NM_207151.1
NBCI Gene record:
Olfr1308 (258258)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207151.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000189154 GCAAGCATGACAGGAAACTCT pLKO.1 109 CDS 100% 3.000 2.100 N Olfr1308 n/a
2 TRCN0000188305 CCCAAGGATGTGCATCTTGTT pLKO.1 411 CDS 100% 4.950 2.970 N Olfr1308 n/a
3 TRCN0000202574 CCTTCTTCATACTGATCATTT pLKO.1 629 CDS 100% 13.200 6.600 Y Olfr1306 n/a
4 TRCN0000204779 GCCATGGCCTTTGACAGATAT pLKO.1 349 CDS 100% 13.200 6.600 Y OR4F3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207151.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.