Transcript: Human NM_207335.3

Homo sapiens kelch repeat and BTB domain containing 12 (KBTBD12), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-25
Taxon:
Homo sapiens (human)
Gene:
KBTBD12 (166348)
Length:
5738
CDS:
468..2339

Additional Resources:

NCBI RefSeq record:
NM_207335.3
NBCI Gene record:
KBTBD12 (166348)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_207335.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147526 GAAGTACTCTAAGTACCGATT pLKO.1 1901 CDS 100% 4.050 5.670 N KBTBD12 n/a
2 TRCN0000149854 CCAGCCTGATAGGGTAAATAA pLKO.1 2519 3UTR 100% 15.000 10.500 N KBTBD12 n/a
3 TRCN0000150295 CATGAGGTTATCTCCAAAGAA pLKO.1 2163 CDS 100% 5.625 3.938 N KBTBD12 n/a
4 TRCN0000148335 CCTTCAGATTTGGTGGAAGAA pLKO.1 2304 CDS 100% 4.950 3.465 N KBTBD12 n/a
5 TRCN0000149264 GCTGTAGTCAACAGTGAGATT pLKO.1 1929 CDS 100% 4.950 3.465 N KBTBD12 n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4805 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 4642 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4805 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207335.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.