Transcript: Human NM_207406.4

Homo sapiens BEN domain containing 4 (BEND4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
BEND4 (389206)
Length:
8627
CDS:
358..1962

Additional Resources:

NCBI RefSeq record:
NM_207406.4
NBCI Gene record:
BEND4 (389206)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_207406.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245693 GTCCATGATTTCTTGCGTAAA pLKO_005 942 CDS 100% 10.800 15.120 N BEND4 n/a
2 TRCN0000245694 GCTAAATGGACAGCGTTTATT pLKO_005 3256 3UTR 100% 15.000 12.000 N BEND4 n/a
3 TRCN0000168892 CGAATGATCTTGGATGCCTTT pLKO.1 850 CDS 100% 4.050 3.240 N BEND4 n/a
4 TRCN0000168001 CAGTCCATGATTTCTTGCGTA pLKO.1 940 CDS 100% 2.640 2.112 N BEND4 n/a
5 TRCN0000245695 AGCTGGAGCAGGAGGTTATTT pLKO_005 1340 CDS 100% 15.000 10.500 N BEND4 n/a
6 TRCN0000245692 CTTCGATACCTCATCAGATTT pLKO_005 1600 CDS 100% 13.200 9.240 N BEND4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207406.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.