Transcript: Human NM_207410.2

Homo sapiens GDNF family receptor alpha like (GFRAL), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
GFRAL (389400)
Length:
1911
CDS:
87..1271

Additional Resources:

NCBI RefSeq record:
NM_207410.2
NBCI Gene record:
GFRAL (389400)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_207410.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130147 CAACCACGTCAAGACAACAAT pLKO.1 1683 3UTR 100% 5.625 7.875 N GFRAL n/a
2 TRCN0000129264 CGTTCCCATCATGGATTCAAA pLKO.1 444 CDS 100% 5.625 7.875 N GFRAL n/a
3 TRCN0000129022 GCCATACGGTTCTTCTATCAA pLKO.1 594 CDS 100% 5.625 7.875 N GFRAL n/a
4 TRCN0000130317 GCAAATGGAAATCCGTGTGAT pLKO.1 555 CDS 100% 4.950 6.930 N GFRAL n/a
5 TRCN0000428400 ATAACGTGAAAGAGGATAAAT pLKO_005 403 CDS 100% 15.000 12.000 N GFRAL n/a
6 TRCN0000419676 CAATGCTTACGTGATGCAAAT pLKO_005 174 CDS 100% 10.800 7.560 N GFRAL n/a
7 TRCN0000128289 GCACTGATGACTTCTATTGTA pLKO.1 340 CDS 100% 5.625 3.938 N GFRAL n/a
8 TRCN0000129051 GTGACTGTGCTCAATCTGATA pLKO.1 652 CDS 100% 4.950 3.465 N GFRAL n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1655 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1655 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207410.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.