Transcript: Human NM_207437.3

Homo sapiens dynein axonemal heavy chain 10 (DNAH10), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-14
Taxon:
Homo sapiens (human)
Gene:
DNAH10 (196385)
Length:
13716
CDS:
26..13441

Additional Resources:

NCBI RefSeq record:
NM_207437.3
NBCI Gene record:
DNAH10 (196385)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_207437.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151525 CAAATGTTCGAGACCATGTTA pLKO.1 6317 CDS 100% 5.625 7.875 N DNAH10 n/a
2 TRCN0000151858 CGAGAGGAAATTCATCAACAT pLKO.1 7285 CDS 100% 4.950 6.930 N DNAH10 n/a
3 TRCN0000155655 CCGTCGTCATTAACACTCTGT pLKO.1 6384 CDS 100% 2.640 3.696 N DNAH10 n/a
4 TRCN0000155686 CTGAGGTTTAATGACGGCGAT pLKO.1 4829 CDS 100% 2.160 3.024 N DNAH10 n/a
5 TRCN0000153421 GACGATGAGTTGCTTAGCATT pLKO.1 4742 CDS 100% 4.950 3.960 N DNAH10 n/a
6 TRCN0000155185 GCTGTCCAAGCAGTATCACTA pLKO.1 6010 CDS 100% 4.950 3.960 N DNAH10 n/a
7 TRCN0000152576 GCGTTGCTAGAAGGAGAAATA pLKO.1 7001 CDS 100% 13.200 9.240 N DNAH10 n/a
8 TRCN0000152122 CCAACCTTGTATGACTTTCAT pLKO.1 7199 CDS 100% 5.625 3.938 N DNAH10 n/a
9 TRCN0000151710 CCAGAGACATAGTTGATTCTT pLKO.1 5268 CDS 100% 5.625 3.938 N DNAH10 n/a
10 TRCN0000154043 CCCTATCTCATGGATGTGATA pLKO.1 6881 CDS 100% 4.950 3.465 N DNAH10 n/a
11 TRCN0000153230 GAAGGAGAAGTCATGGAGTTT pLKO.1 4886 CDS 100% 4.950 3.465 N DNAH10 n/a
12 TRCN0000153057 GCCAGAGACATAGTTGATTCT pLKO.1 5267 CDS 100% 4.950 3.465 N DNAH10 n/a
13 TRCN0000141788 GAAGAGGGAGAAGAGGAAGAA pLKO.1 77 CDS 100% 4.950 2.475 Y FAM9B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207437.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.