Transcript: Mouse NM_207563.2

Mus musculus olfactory receptor 1057 (Olfr1057), mRNA.

Source:
NCBI, updated 2012-08-25
Taxon:
Mus musculus (mouse)
Gene:
Olfr1057 (404325)
Length:
948
CDS:
1..948

Additional Resources:

NCBI RefSeq record:
NM_207563.2
NBCI Gene record:
Olfr1057 (404325)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207563.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000185198 CTTTCTCTTCTTGGTCATCTA pLKO.1 84 CDS 100% 4.950 2.970 N Olfr1057 n/a
2 TRCN0000185941 CCTTCCAGAAACTGTTGTATT pLKO.1 579 CDS 100% 13.200 6.600 Y Olfr1057 n/a
3 TRCN0000185623 GTGTGTTCTCTGTTTCTTATT pLKO.1 485 CDS 100% 13.200 6.600 Y Olfr1062 n/a
4 TRCN0000188274 CCTGCAAACTCCCATGTACTT pLKO.1 162 CDS 100% 4.950 2.475 Y Olfr1057 n/a
5 TRCN0000185942 CTTCTCTTCATGTATCTACAA pLKO.1 763 CDS 100% 4.950 2.475 Y Olfr1057 n/a
6 TRCN0000204163 GCAAACTCCCATGTACTTCTT pLKO.1 165 CDS 100% 4.950 2.475 Y Olfr1062 n/a
7 TRCN0000185972 GTTTCTTATTGCTCTTCCAAT pLKO.1 496 CDS 100% 4.950 2.475 Y Olfr1057 n/a
8 TRCN0000204635 GCCATTGTTGTGACACCTTGT pLKO.1 466 CDS 100% 4.050 2.025 Y Olfr1062 n/a
9 TRCN0000188445 CAGCCATTGTTGTGACACCTT pLKO.1 464 CDS 100% 2.640 1.320 Y Olfr1062 n/a
10 TRCN0000204152 GAAGGAAGAAAGCCTTCTCTA pLKO.1 698 CDS 100% 0.495 0.248 Y Olfr1062 n/a
11 TRCN0000185394 GTCAACTTCTTAGTCAGTAAA pLKO.1 247 CDS 100% 13.200 6.600 Y Olfr1062 n/a
12 TRCN0000060371 CCATGTACTTCTTCCTCAGAA pLKO.1 173 CDS 100% 4.950 2.475 Y OR10A2 n/a
13 TRCN0000188492 CCCATGTACTTCTTCCTCACA pLKO.1 172 CDS 100% 2.640 1.320 Y Olfr317 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207563.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.