Transcript: Mouse NM_207648.1

Mus musculus histocompatibility 2, Q region locus 6 (H2-Q6), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
H2-Q6 (110557)
Length:
981
CDS:
1..981

Additional Resources:

NCBI RefSeq record:
NM_207648.1
NBCI Gene record:
H2-Q6 (110557)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207648.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066907 GAATTACACATGCCATGTGAA pLKO.1 828 CDS 100% 4.950 2.475 Y H2-Q6 n/a
2 TRCN0000066905 GACCGCACAGAGATACTACAA pLKO.1 300 CDS 100% 4.950 2.475 Y H2-Q6 n/a
3 TRCN0000066566 GCCCTGAACGAAGACCTGAAA pLKO.1 436 CDS 100% 4.950 2.475 Y H2-Q8 n/a
4 TRCN0000066906 GAGATACTACAACCAGAGCAA pLKO.1 309 CDS 100% 2.640 1.320 Y H2-Q6 n/a
5 TRCN0000066903 GAGCAGAATTACACATGCCAT pLKO.1 823 CDS 100% 2.640 1.320 Y H2-Q6 n/a
6 TRCN0000192133 GAGCAGAATTACACATGCCAT pLKO.1 823 CDS 100% 2.640 1.320 Y H2-D1 n/a
7 TRCN0000066904 CCGGTTCATTATCGTCGGCTA pLKO.1 123 CDS 100% 2.160 1.080 Y H2-Q6 n/a
8 TRCN0000066563 CCGCGATTACATCGCCCTGAA pLKO.1 423 CDS 100% 1.350 0.675 Y H2-Q8 n/a
9 TRCN0000066666 CCAGTGGATGTATGGCTGTAA pLKO.1 348 CDS 100% 4.950 2.475 Y H2-Q10 n/a
10 TRCN0000066567 GTGGATGTATGGCTGTGACAT pLKO.1 351 CDS 100% 4.950 2.475 Y H2-Q8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207648.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.