Transcript: Human NM_213569.2

Homo sapiens nebulette (NEBL), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
NEBL (10529)
Length:
6956
CDS:
355..1167

Additional Resources:

NCBI RefSeq record:
NM_213569.2
NBCI Gene record:
NEBL (10529)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_213569.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431237 AGGAATGCTCCCAGCGAATTA pLKO_005 1128 CDS 100% 13.200 9.240 N NEBL n/a
2 TRCN0000108797 ACAACTACAAAGGCTATGAAA pLKO.1 479 CDS 100% 5.625 3.938 N Nebl n/a
3 TRCN0000108799 GTATTGGCATAAAGGATGTTT pLKO.1 423 CDS 100% 5.625 3.938 N Nebl n/a
4 TRCN0000183854 CCTCAGATATTAAAGGTGTTA pLKO.1 4750 3UTR 100% 4.950 3.465 N NEBL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_213569.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07628 pDONR223 100% 23% 18.3% None (many diffs) n/a
2 ccsbBroad304_07628 pLX_304 0% 23% 18.3% V5 (many diffs) n/a
Download CSV