Transcript: Human NM_213656.4

Homo sapiens keratin 39 (KRT39), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
KRT39 (390792)
Length:
1752
CDS:
93..1568

Additional Resources:

NCBI RefSeq record:
NM_213656.4
NBCI Gene record:
KRT39 (390792)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_213656.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108266 CCCTGTTCTATGTCCTGATTA pLKO.1 500 CDS 100% 13.200 9.240 N KRT39 n/a
2 TRCN0000442626 AGTGGTTCAACACGCAGATAG pLKO_005 946 CDS 100% 10.800 7.560 N KRT39 n/a
3 TRCN0000108267 CCCAGCATCGAATGAGAGATT pLKO.1 1075 CDS 100% 4.950 3.465 N KRT39 n/a
4 TRCN0000108268 GCTCTAGGATTACAAATGTTA pLKO.1 148 CDS 100% 5.625 3.375 N KRT39 n/a
5 TRCN0000108269 GCAGATGACTTGAGAGCCAAA pLKO.1 624 CDS 100% 4.050 2.430 N KRT39 n/a
6 TRCN0000108265 CATTTATGAAACAGAGGCCAA pLKO.1 1595 3UTR 100% 2.160 1.296 N KRT39 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_213656.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.