Transcript: Human NR_002726.2

Homo sapiens heterogeneous nuclear ribonucleoprotein A3 pseudogene 1 (HNRNPA3P1), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
HNRNPA3P1 (10151)
Length:
3006
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_002726.2
NBCI Gene record:
HNRNPA3P1 (10151)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_002726.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039568 TGACTTATTCTTGTGTTACAG pLKO.1 272 3UTR 100% 4.950 3.465 N HNRNPA3P1 n/a
2 TRCN0000039570 GAGGAGGTGATGTGGATATAA pLKO.1 812 3UTR 100% 15.000 9.000 N HNRNPA3P1 n/a
3 TRCN0000039571 GTGATGTGGATATAATGGATT pLKO.1 818 3UTR 100% 4.950 2.970 N HNRNPA3P1 n/a
4 TRCN0000112093 GTTACAATGAAGGAGGAAATT pLKO.1 964 3UTR 100% 13.200 6.600 Y Hnrnpa3 n/a
5 TRCN0000074509 CCACACTATTAATGGGCATAA pLKO.1 594 3UTR 100% 10.800 5.400 Y HNRNPA3 n/a
6 TRCN0000074510 GCCCATCTAACAGTGAAGAAA pLKO.1 391 3UTR 100% 5.625 2.813 Y HNRNPA3 n/a
7 TRCN0000074508 GCTTTGAAACTACAGATGATA pLKO.1 158 3UTR 100% 5.625 2.813 Y HNRNPA3 n/a
8 TRCN0000221614 TGGAGGATATGATGGTTACAA pLKO.1 950 3UTR 100% 5.625 2.813 Y HNRNPA3P5 n/a
9 TRCN0000039569 GAGGCCCATAAATCTTGAGTT pLKO.1 2217 3UTR 100% 4.950 2.475 Y HNRNPA3P1 n/a
10 TRCN0000221610 GTGGTGGATATGGTAGCAGAA pLKO.1 1141 3UTR 100% 4.050 2.025 Y HNRNPA3P5 n/a
11 TRCN0000221612 CCTATGGTGGTGGTTATGGAT pLKO.1 1108 3UTR 100% 3.000 1.500 Y HNRNPA3P5 n/a
12 TRCN0000039572 AGGTAGTTATGGAGGAGGTGA pLKO.1 801 3UTR 100% 2.640 1.320 Y HNRNPA3P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_002726.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.