Transcript: Mouse NR_003555.1

Mus musculus vomeronasal 2, receptor 29 (Vmn2r29), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Vmn2r29 (76229)
Length:
1609
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003555.1
NBCI Gene record:
Vmn2r29 (76229)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_003555.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104872 CTAATGAGACAACGATGGCCA pLKO.1 784 3UTR 100% 0.660 0.462 N Vmn2r29 n/a
2 TRCN0000239401 TTTCCCAGTATTCAGTGAAAC pLKO_005 195 3UTR 100% 10.800 5.400 Y 2810047C21Rik1 n/a
3 TRCN0000104871 CTTGGGATTAAGCTGAAGTTA pLKO.1 567 3UTR 100% 5.625 2.813 Y Vmn2r29 n/a
4 TRCN0000104874 GTTAGGAAAGTTCAGCCCATA pLKO.1 584 3UTR 100% 4.050 2.025 Y Vmn2r29 n/a
5 TRCN0000104873 CGACACTTTCACTTATACGTA pLKO.1 618 3UTR 100% 3.000 1.500 Y Vmn2r29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003555.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.