Transcript: Human NR_004401.2

Homo sapiens secretory blood group 1, pseudogene (SEC1P), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
SEC1P (653677)
Length:
2649
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_004401.2
NBCI Gene record:
SEC1P (653677)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_004401.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036100 TCCACCTTCTACTTCGTCTTT pLKO.1 464 3UTR 100% 4.950 3.465 N FUT2 n/a
2 TRCN0000036099 CCTGTTCACTATCAACTCCAA pLKO.1 601 3UTR 100% 2.640 1.848 N FUT2 n/a
3 TRCN0000036103 CTGGCAGAACTACCACCTGAA pLKO.1 784 3UTR 100% 4.050 2.025 Y FUT2 n/a
4 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 2009 3UTR 100% 4.050 2.025 Y P3H4 n/a
5 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 2009 3UTR 100% 4.050 2.025 Y ORAI2 n/a
6 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 2009 3UTR 100% 4.050 2.025 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_004401.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.