Transcript: Human NR_024495.2

Homo sapiens BMS1 pseudogene 2 (BMS1P2), non-coding RNA.

Source:
NCBI, updated 2019-01-21
Taxon:
Homo sapiens (human)
Gene:
BMS1P2 (642826)
Length:
4704
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_024495.2
NBCI Gene record:
BMS1P2 (642826)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_024495.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_024495.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10370 pDONR223 100% 6.1% None (many diffs) n/a
2 ccsbBroad304_10370 pLX_304 0% 6.1% V5 (many diffs) n/a
3 TRCN0000467881 ATCACAGGCGGCGTAGCCGACCCG pLX_317 71.9% 6.1% V5 (many diffs) n/a
Download CSV