Transcript: Mouse NR_024720.1

Mus musculus RIKEN cDNA 2700099C18 gene (2700099C18Rik), non-coding RNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
2700099C18Rik (77022)
Length:
1275
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_024720.1
NBCI Gene record:
2700099C18Rik (77022)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_024720.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087828 GCCGAAATCAAAGCACTAAAT pLKO.1 363 3UTR 100% 13.200 9.240 N LOC385028 n/a
2 TRCN0000087829 CTGGATGACCTTTACCAACAA pLKO.1 904 3UTR 100% 4.950 3.465 N LOC385028 n/a
3 TRCN0000087832 CCTGTCAAATACAGGACTCAA pLKO.1 711 3UTR 100% 0.495 0.297 N LOC385028 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_024720.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.