Transcript: Human NR_026713.1

Homo sapiens family with sequence similarity 182 member A (FAM182A), long non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
FAM182A (284800)
Length:
5111
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_026713.1
NBCI Gene record:
FAM182A (284800)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_026713.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127959 CTGGAACTACTGTGAGGGTTT pLKO.1 843 3UTR 100% 4.050 2.835 N FAM182A n/a
2 TRCN0000130520 GAGAGAACTTTGGATGTGGAA pLKO.1 892 3UTR 100% 2.640 1.584 N FAM182A n/a
3 TRCN0000129074 GATGTCTATCTGTGGCCTTAT pLKO.1 1367 3UTR 100% 10.800 5.400 Y FAM182A n/a
4 TRCN0000128772 CAGAAGAGTGTCCACAAACTT pLKO.1 1061 3UTR 100% 5.625 2.813 Y FAM182A n/a
5 TRCN0000127954 CCACCTAGGAACCTGATGTAT pLKO.1 2478 3UTR 100% 5.625 2.813 Y FAM182A n/a
6 TRCN0000130753 GCAAGGAGCATGATGGTACTT pLKO.1 1152 3UTR 100% 4.950 2.475 Y FAM182A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_026713.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10605 pDONR223 100% 9% None 1_709del;1118G>A;1172_5111del n/a
2 ccsbBroad304_10605 pLX_304 0% 9% V5 1_709del;1118G>A;1172_5111del n/a
Download CSV