Transcript: Human NR_026868.1

Homo sapiens ankyrin repeat domain 19, pseudogene (ANKRD19P), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
ANKRD19P (138649)
Length:
2307
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_026868.1
NBCI Gene record:
ANKRD19P (138649)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_026868.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152209 CGAGGATTATGCTGTTTGTTA pLKO.1 762 3UTR 100% 5.625 3.375 N ANKRD19P n/a
2 TRCN0000155030 GAGCAGAAGATGCCAGATCAA pLKO.1 318 3UTR 100% 4.950 2.970 N ANKRD19P n/a
3 TRCN0000153272 GCCATTATTCTCCTGGAACAT pLKO.1 403 3UTR 100% 4.950 2.970 N ANKRD19P n/a
4 TRCN0000152379 GCCAATCCAAACATTAAGGAT pLKO.1 427 3UTR 100% 3.000 1.500 Y ANKRD19P n/a
5 TRCN0000151931 CCATGCAAATATTGAAGCACT pLKO.1 522 3UTR 100% 2.640 1.320 Y ANKRD19P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_026868.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.