Transcript: Human NR_027331.1

Homo sapiens long intergenic non-protein coding RNA 696 (LINC00696), long non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
LINC00696 (100128378)
Length:
3019
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027331.1
NBCI Gene record:
LINC00696 (100128378)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027331.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000269910 GGAGTGTGCAAGCCCATTAAG pLKO_005 2196 3UTR 100% 13.200 18.480 N LINC00696 n/a
2 TRCN0000269914 AGGCGTTTGGTAGCACGAATG pLKO_005 1815 3UTR 100% 6.000 8.400 N LINC00696 n/a
3 TRCN0000269912 ATTGAGTACTGGGATGGATTA pLKO_005 1769 3UTR 100% 10.800 7.560 N LINC00696 n/a
4 TRCN0000269911 CTCCCTGTGGACTGTACTTGA pLKO_005 1957 3UTR 100% 4.950 3.465 N LINC00696 n/a
5 TRCN0000269913 GACAGAGCCCTTCTCTTTATG pLKO_005 1846 3UTR 100% 13.200 7.920 N LINC00696 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027331.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10261 pDONR223 100% 2% None (many diffs) n/a
2 ccsbBroad304_10261 pLX_304 0% 2% V5 (many diffs) n/a
3 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% 2% V5 (many diffs) n/a
Download CSV