Construct: ORF TRCN0000492083

Construct Description:

Construct Type:
ORF
Other Identifiers:
ORF003652.3_s317c1
Derived from:
ccsbBroadEn_10261
DNA Barcode:
TTATAGGCCCAGAGCACTACCAAC
Epitope Tag:
V5
Notes:
No stop codon in insert

Originally Annotated References:

Gene:
ZNF205-AS1 (81854)

Vector Information:

Vector Backbone:
pLX_317
Pol II Cassette 1:
SV40-PuroR
Pol II Cassette 2:
EF1a-TRCN0000492083
Selection Marker:
PuroR
Visible Reporter:
n/a
Epitope Tag:
n/a

Current transcripts matched by this ORF:

Taxon Gene Symbol Description Transcript Nuc. Match %[?] Prot. Match %[?] Match Diffs[?]
1 human 10611 PDLIM5 PDZ and LIM domain 5 NM_001256429.2 14.8% 13.2% (many diffs)
2 human 7700 ZNF141 zinc finger protein 141 NM_001348279.2 9.7% 6% (many diffs)
3 human 101929224 DDX59-AS1 DDX59 antisense RNA 1 NR_110787.1 8.6% (many diffs)
4 human 105371493 LOC105371493 uncharacterized LOC105371493 XR_934165.2 8.4% (many diffs)
5 human 102724030 LOC102724030 uncharacterized LOC102724030 XR_429139.2 6.7% (many diffs)
6 human 7189 TRAF6 TNF receptor associated fac... XM_017018220.1 6.4% 5.5% (many diffs)
7 human 102724030 LOC102724030 uncharacterized LOC102724030 XR_001749159.1 6.1% (many diffs)
8 human 100132169 WASIR2 WASH and IL9R antisense RNA 2 NR_130735.1 6.1% (many diffs)
9 human 105371493 LOC105371493 uncharacterized LOC105371493 XR_934164.2 6% (many diffs)
10 human 2323 FLT3LG fms related tyrosine kinase... XR_935781.2 5.9% (many diffs)
11 human 81854 ZNF205-AS1 ZNF205 antisense RNA 1 NR_024167.1 5.8% 1_884del;957_1228del
12 human 81854 ZNF205-AS1 ZNF205 antisense RNA 1 NR_024166.1 5.8% 1_889del;962_1233del
13 human 2323 FLT3LG fms related tyrosine kinase... XR_935782.2 5.8% (many diffs)
14 human 101928113 ST3GAL5-AS1 ST3GAL5 antisense RNA 1 (he... NR_110569.1 5.7% (many diffs)
15 human 124801 LSM12 LSM12 homolog NM_001369484.1 5.7% 5.8% (many diffs)
16 human 107984875 LOC107984875 uncharacterized LOC107984875 XR_001752116.2 5.7% (many diffs)
17 human 105375013 HCG20 HLA complex group 20 NR_138037.1 5.2% (many diffs)
18 human 100128260 WASIR1 WASH and IL9R antisense RNA 1 NR_138048.1 5.1% (many diffs)
19 human 105371982 LOC105371982 uncharacterized LOC105371982 XR_935133.3 5.1% (many diffs)
20 human 101927632 PPP1R35-AS1 PPP1R35 antisense RNA 1 XR_927812.2 5.1% (many diffs)
21 human 80167 ABHD18 abhydrolase domain containi... NM_001366038.2 5% 4.8% (many diffs)
22 human 105370926 LOC105370926 uncharacterized LOC105370926 XR_932534.3 4.8% (many diffs)
23 human 55620 STAP2 signal transducing adaptor ... XM_011528123.1 4.7% 4.4% (many diffs)
24 human 105372308 LOC105372308 uncharacterized LOC105372308 XR_001754062.1 4.7% (many diffs)
25 human 55620 STAP2 signal transducing adaptor ... NM_017720.3 4.7% 4.4% (many diffs)
26 human 340037 PRR7-AS1 PRR7 antisense RNA 1 NR_038916.1 4.7% (many diffs)
27 human 107984852 LOC107984852 uncharacterized LOC107984852 XR_001752221.2 4.6% (many diffs)
28 human 105372439 LOC105372439 uncharacterized LOC105372439 XR_936026.2 4.5% 0_1ins42;14T>C;30_568delinsC
29 human 100128233 LINC02324 long intergenic non-protein... NR_103769.1 4.5% (many diffs)
30 human 105375863 LOC105375863 uncharacterized LOC105375863 XR_928934.2 4.4% (many diffs)
31 human 107984334 LOC107984334 uncharacterized LOC107984334 XR_001748245.1 4.2% (many diffs)
32 human 101928738 LINC01978 long intergenic non-protein... NR_110851.1 4.2% (many diffs)
33 human 340037 PRR7-AS1 PRR7 antisense RNA 1 NR_038915.1 4.1% (many diffs)
34 human 105371493 LOC105371493 uncharacterized LOC105371493 XR_001752761.2 4.1% (many diffs)
35 human 105372446 LOC105372446 uncharacterized LOC105372446 XR_002958398.1 4.1% (many diffs)
36 human 107985297 LOC107985297 uncharacterized LOC107985297 XR_001753847.2 4% (many diffs)
37 human 55762 ZNF701 zinc finger protein 701 NM_001172655.1 4% 3.9% (many diffs)
38 human 105378651 LOC105378651 uncharacterized LOC105378651 XR_001737982.1 4% (many diffs)
39 human 26610 ELP4 elongator acetyltransferase... NM_001288726.2 3.9% 3.7% (many diffs)
40 human 10611 PDLIM5 PDZ and LIM domain 5 NR_046186.2 3.9% (many diffs)
41 human 105371493 LOC105371493 uncharacterized LOC105371493 XR_001752760.1 3.8% (many diffs)
42 human 105369373 LOC105369373 uncharacterized LOC105369373 XR_950279.2 3.7% (many diffs)
43 human 221060 RPP38-DT RPP38 divergent transcript NR_160789.1 3.7% (many diffs)
44 human 105369325 LOC105369325 uncharacterized LOC105369325 XR_950154.2 3.7% (many diffs)
45 human 135398 C6orf141 chromosome 6 open reading f... NR_146855.2 3.7% (many diffs)
46 human 100128025 WWTR1-AS1 WWTR1 antisense RNA 1 NR_040250.1 3.7% (many diffs)
47 human 64109 CRLF2 cytokine receptor like fact... NR_110830.2 3.6% (many diffs)
48 human 729082 OIP5-AS1 OIP5 antisense RNA 1 NR_152821.1 3.6% (many diffs)
49 human 152816 ODAPH odontogenesis associated ph... NR_046430.2 3.5% (many diffs)
50 human 152816 ODAPH odontogenesis associated ph... NR_046429.2 3.5% (many diffs)
51 human 105376412 LOC105376412 uncharacterized LOC105376412 XR_930661.2 3.4% (many diffs)
52 human 135398 C6orf141 chromosome 6 open reading f... NR_146856.2 3.4% (many diffs)
53 human 105371493 LOC105371493 uncharacterized LOC105371493 XR_001752758.1 3.4% (many diffs)
54 human 105375924 LOC105375924 uncharacterized LOC105375924 XR_002956720.1 3.4% (many diffs)
55 human 100885795 LARS2-AS1 LARS2 antisense RNA 1 NR_048543.1 3.3% (many diffs)
56 human 344387 CDKL4 cyclin dependent kinase like 4 NR_144521.1 3.3% (many diffs)
57 human 102725068 MICB-DT MICB divergent transcript NR_149132.1 3.3% (many diffs)
58 human 101929272 DTNB-AS1 DTNB antisense RNA 1 XR_427012.3 3.2% (many diffs)
59 human 101929130 LOC101929130 uncharacterized LOC101929130 NR_135551.1 3.2% (many diffs)
60 human 105375758 LOC105375758 uncharacterized LOC105375758 XR_928648.2 3.2% (many diffs)
61 human 101928847 LOC101928847 uncharacterized LOC101928847 NR_120563.1 3.2% (many diffs)
62 human 101927447 LOC101927447 uncharacterized LOC101927447 NR_134582.1 3.2% (many diffs)
63 human 105376412 LOC105376412 uncharacterized LOC105376412 XR_002957063.1 3.1% (many diffs)
64 human 101927653 LINC02388 long intergenic non-protein... NR_120452.1 3.1% (many diffs)
65 human 653399 GSTTP2 glutathione S-transferase t... NR_003082.1 3.1% (many diffs)
66 human 101929272 DTNB-AS1 DTNB antisense RNA 1 XR_244976.3 3.1% (many diffs)
67 human 123811 FOPNL FGFR1OP N-terminal like NR_130757.2 3.1% (many diffs)
68 human 101929272 DTNB-AS1 DTNB antisense RNA 1 XR_002959375.1 3% (many diffs)
69 human 107987174 LOC107987174 uncharacterized LOC107987174 XR_001748997.1 3% (many diffs)
70 human 55344 PLCXD1 phosphatidylinositol specif... NR_028057.2 3% (many diffs)
71 human 100507501 LINC01569 long intergenic non-protein... NR_039999.1 3% (many diffs)
72 human 105378688 LOC105378688 uncharacterized LOC105378688 XR_947283.1 3% (many diffs)
73 human 126364 LRRC25 leucine rich repeat contain... XR_001753602.2 3% (many diffs)
74 human 102723854 LINC01819 long intergenic non-protein... NR_110585.1 2.9% (many diffs)
75 human 101929272 DTNB-AS1 DTNB antisense RNA 1 XR_939844.2 2.9% (many diffs)
76 human 101928151 LINC01179 long intergenic non-protein... NR_121676.1 2.9% (many diffs)
77 human 102724015 LOC102724015 uncharacterized LOC102724015 XR_001750808.2 2.9% (many diffs)
78 human 105370384 LOC105370384 uncharacterized LOC105370384 XR_001750059.1 2.9% (many diffs)
79 human 654434 SNHG20 small nucleolar RNA host ge... NR_027058.1 2.8% (many diffs)
80 human 123811 FOPNL FGFR1OP N-terminal like NR_130755.2 2.8% (many diffs)
81 human 140564 APOBEC3D apolipoprotein B mRNA editi... XR_001755170.2 2.8% (many diffs)
82 human 9616 RNF7 ring finger protein 7 NR_037703.1 2.8% (many diffs)
83 human 9616 RNF7 ring finger protein 7 NR_037702.1 2.8% (many diffs)
84 human 107987304 LOC107987304 uncharacterized LOC107987304 XR_001755093.1 2.7% (many diffs)
85 human 105370384 LOC105370384 uncharacterized LOC105370384 XR_001750054.1 2.7% (many diffs)
86 human 105370384 LOC105370384 uncharacterized LOC105370384 XR_001750057.1 2.7% (many diffs)
87 human 101927415 TMED2-DT TMED2 divergent transcript NR_110049.2 2.7% (many diffs)
88 human 135398 C6orf141 chromosome 6 open reading f... NR_146858.2 2.7% (many diffs)
89 human 80161 ASMTL-AS1 ASMTL antisense RNA 1 NR_026711.1 2.7% (many diffs)
90 human 54879 ST7L suppression of tumorigenici... XR_001737250.1 2.7% (many diffs)
91 human 220074 LRTOMT leucine rich transmembrane ... NR_134858.1 2.7% (many diffs)
92 human 1992 SERPINB1 serpin family B member 1 NR_073112.2 2.6% (many diffs)
93 human 107987151 LOC107987151 uncharacterized LOC107987151 XR_001747604.2 2.6% (many diffs)
94 human 100190986 LOC100190986 uncharacterized LOC100190986 NR_024456.1 2.6% (many diffs)
95 human 100192420 LINC01634 long intergenic non-protein... NR_024417.1 2.6% (many diffs)
96 human 135398 C6orf141 chromosome 6 open reading f... NR_146853.2 2.6% (many diffs)
97 human 105370384 LOC105370384 uncharacterized LOC105370384 XR_001750056.1 2.6% (many diffs)
98 human 123811 FOPNL FGFR1OP N-terminal like NR_130756.2 2.6% (many diffs)
99 human 135398 C6orf141 chromosome 6 open reading f... NR_146854.2 2.6% (many diffs)
100 human 140564 APOBEC3D apolipoprotein B mRNA editi... XR_001755169.2 2.6% (many diffs)
101 human 107987326 LOC107987326 uncharacterized LOC107987326 XR_001755583.1 2.5% (many diffs)
102 human 101928555 LINC01537 long intergenic non-protein... NR_126364.1 2.5% (many diffs)
103 human 118980 SFXN2 sideroflexin 2 NR_146992.1 2.5% (many diffs)
104 human 137695 TMEM68 transmembrane protein 68 NR_156454.1 2.5% (many diffs)
105 human 728606 PCAT18 prostate cancer associated ... NR_024259.1 2.5% (many diffs)
106 human 1992 SERPINB1 serpin family B member 1 NR_073111.2 2.5% (many diffs)
107 human 147276 C18orf15 chromosome 18 open reading ... NR_146617.1 2.5% (many diffs)
108 human 283089 WDR11-AS1 WDR11 antisense RNA 1 NR_033850.1 2.5% (many diffs)
109 human 730227 LINC01136 long intergenic non-protein... NR_034150.1 2.5% (many diffs)
110 human 105370384 LOC105370384 uncharacterized LOC105370384 XR_001750055.1 2.4% (many diffs)
111 human 105374423 LOC105374423 uncharacterized LOC105374423 XR_925251.3 2.4% (many diffs)
112 human 135398 C6orf141 chromosome 6 open reading f... NR_146863.2 2.4% (many diffs)
113 human 101060542 LINC01910 long intergenic non-protein... NR_110764.1 2.4% (many diffs)
114 human 107984577 LOC107984577 uncharacterized LOC107984577 XR_001749803.1 2.4% (many diffs)
115 human 883 KYAT1 kynurenine aminotransferase 1 NR_148224.1 2.4% (many diffs)
116 human 135398 C6orf141 chromosome 6 open reading f... NR_146857.2 2.4% (many diffs)
117 human 101929010 SIRPG-AS1 SIRPG antisense RNA 1 NR_110090.1 2.3% (many diffs)
118 human 440600 RBM15-AS1 RBM15 antisense RNA 1 NR_036595.1 2.3% (many diffs)
119 human 105369347 RELA-DT RELA divergent transcript XR_002957252.1 2.3% (many diffs)
120 human 107986847 LOC107986847 uncharacterized LOC107986847 XR_001745359.2 2.3% (many diffs)
121 human 1677 DFFB DNA fragmentation factor su... NR_135152.2 2.3% (many diffs)
122 human 387723 C10orf143 chromosome 10 open reading ... NR_034125.1 2.3% (many diffs)
123 human 100130581 LINC00910 long intergenic non-protein... NR_027412.1 2.3% (many diffs)
124 human 105370384 LOC105370384 uncharacterized LOC105370384 XR_001750053.1 2.3% (many diffs)
125 human 730227 LINC01136 long intergenic non-protein... NR_034151.1 2.3% (many diffs)
126 human 57127 RHBG Rh family B glycoprotein (g... NR_146763.2 2.3% (many diffs)
127 human 220074 LRTOMT leucine rich transmembrane ... NR_026886.3 2.3% (many diffs)
128 human 9617 MTRF1 mitochondrial translation r... XR_001749744.2 2.3% (many diffs)
129 human 51379 CRLF3 cytokine receptor like fact... XR_001752525.2 2.3% (many diffs)
130 human 57446 NDRG3 NDRG family member 3 NR_038370.2 2.2% (many diffs)
131 human 1677 DFFB DNA fragmentation factor su... NR_135151.2 2.2% (many diffs)
132 human 51379 CRLF3 cytokine receptor like fact... NR_073118.1 2.2% (many diffs)
133 human 1677 DFFB DNA fragmentation factor su... NR_135150.2 2.2% (many diffs)
134 human 1677 DFFB DNA fragmentation factor su... NR_104222.2 2.2% (many diffs)
135 human 92070 CTBP1-DT CTBP1 divergent transcript NR_033339.1 2.2% (many diffs)
136 human 135398 C6orf141 chromosome 6 open reading f... NR_146861.2 2.2% (many diffs)
137 human 101927740 LINC02202 long intergenic non-protein... NR_109890.1 2.2% (many diffs)
138 human 646127 LOC646127 telomeric repeat-binding fa... XR_002958817.1 2.1% (many diffs)
139 human 9609 RAB36 RAB36, member RAS oncogene ... XR_001755385.1 2.1% (many diffs)
140 human 3824 KLRD1 killer cell lectin like rec... XR_001748697.2 2.1% (many diffs)
141 human 643862 SPDYE10P speedy/RINGO cell cycle reg... NR_146079.1 2.1% (many diffs)
142 human 105375758 LOC105375758 uncharacterized LOC105375758 XR_928649.2 2.1% (many diffs)
143 human 107984659 LOC107984659 uncharacterized LOC107984659 XR_001750902.1 2.1% (many diffs)
144 human 101927441 LOC101927441 uncharacterized LOC101927441 XR_946980.3 2.1% (many diffs)
145 human 643711 LOC643711 platelet activating factor ... NR_077240.1 2.1% (many diffs)
146 human 10389 SCML2 Scm polycomb group protein ... NR_033717.2 2.1% (many diffs)
147 human 105372160 LOC105372160 uncharacterized LOC105372160 XR_001753474.2 2.1% (many diffs)
148 human 285989 ZNF789 zinc finger protein 789 NR_147003.2 2.1% (many diffs)
149 human 6103 RPGR retinitis pigmentosa GTPase... NR_159805.1 2.1% (many diffs)
150 human 100128378 LINC00696 long intergenic non-protein... NR_027331.1 2% (many diffs)
151 human 101928514 LINC02080 long intergenic non-protein... NR_110837.1 2% (many diffs)
152 human 105372160 LOC105372160 uncharacterized LOC105372160 XR_001753473.2 2% (many diffs)
153 human 6103 RPGR retinitis pigmentosa GTPase... NR_159808.1 2% (many diffs)
154 human 9601 PDIA4 protein disulfide isomerase... NR_163905.1 2% (many diffs)
155 human 105371554 LOC105371554 uncharacterized LOC105371554 XR_001753080.2 2% (many diffs)
156 human 105375758 LOC105375758 uncharacterized LOC105375758 XR_928646.2 2% (many diffs)
157 human 3824 KLRD1 killer cell lectin like rec... XR_001748696.2 2% (many diffs)
158 human 100131096 TNRC6C-AS1 TNRC6C antisense RNA 1 NR_040071.1 2% (many diffs)
159 human 54939 COMMD4 COMM domain containing 4 NR_104312.2 2% (many diffs)
160 human 6301 SARS1 seryl-tRNA synthetase 1 NR_034072.1 2% (many diffs)
161 human 105370170 LOC105370170 uncharacterized LOC105370170 XR_002957521.1 1.9% (many diffs)
162 human 23582 CCNDBP1 cyclin D1 binding protein 1 NR_045999.2 1.9% (many diffs)
163 human 55344 PLCXD1 phosphatidylinositol specif... NR_163416.1 1.9% (many diffs)
164 human 23582 CCNDBP1 cyclin D1 binding protein 1 NR_027513.3 1.9% (many diffs)
165 human 105375634 LOC105375634 uncharacterized LOC105375634 XR_928392.3 1.9% (many diffs)
166 human 105370384 LOC105370384 uncharacterized LOC105370384 XR_001750058.1 1.9% (many diffs)
167 human 101928045 LOC101928045 uncharacterized LOC101928045 XR_001752979.2 1.9% (many diffs)
168 human 23582 CCNDBP1 cyclin D1 binding protein 1 NR_027514.3 1.9% (many diffs)
169 human 284260 LINC00907 long intergenic non-protein... NR_046456.1 1.8% (many diffs)
170 human 23582 CCNDBP1 cyclin D1 binding protein 1 NR_045998.2 1.8% (many diffs)
171 human 100506637 PRKAR2A-AS1 PRKAR2A antisense RNA 1 NR_109997.1 1.8% (many diffs)
172 human 107985851 LOC107985851 uncharacterized LOC107985851 XR_001739279.1 1.8% (many diffs)
173 human 102723722 LOC102723722 uncharacterized LOC102723722 XR_001756663.1 1.8% (many diffs)
174 human 5140 PDE3B phosphodiesterase 3B NM_001363570.1 1.8% 1.8% (many diffs)
175 human 100422781 LOC100422781 uncharacterized LOC100422781 NR_147505.1 1.8% (many diffs)
176 human 100506637 PRKAR2A-AS1 PRKAR2A antisense RNA 1 NR_109996.1 1.8% (many diffs)
177 human 376497 SLC27A1 solute carrier family 27 me... XR_001753681.1 1.8% (many diffs)
178 human 376497 SLC27A1 solute carrier family 27 me... XR_001753680.1 1.8% (many diffs)
179 human 65117 RSRC2 arginine and serine rich co... NR_036436.2 1.8% (many diffs)
180 human 105375758 LOC105375758 uncharacterized LOC105375758 XR_928647.2 1.8% (many diffs)
181 human 84928 TMEM209 transmembrane protein 209 NR_156699.2 1.8% (many diffs)
182 human 107985485 LOC107985485 uncharacterized LOC107985485 XR_001755092.1 1.8% (many diffs)
183 human 101929201 LOC101929201 uncharacterized LOC101929201 XR_002956216.1 1.7% (many diffs)
184 human 9694 EMC2 ER membrane protein complex... NR_138033.1 1.7% (many diffs)
185 human 92014 SLC25A51 solute carrier family 25 me... NR_024873.2 1.7% (many diffs)
186 human 26608 TBL2 transducin beta like 2 XR_001744627.2 1.7% (many diffs)
187 human 65117 RSRC2 arginine and serine rich co... NR_036434.2 1.7% (many diffs)
188 human 92014 SLC25A51 solute carrier family 25 me... NR_024872.2 1.7% (many diffs)
189 human 65117 RSRC2 arginine and serine rich co... NR_036435.2 1.7% (many diffs)
190 human 100128675 HPN-AS1 HPN antisense RNA 1 NR_024561.1 1.7% (many diffs)
191 human 105375936 LOC105375936 uncharacterized LOC105375936 XR_929126.2 1.7% (many diffs)
192 human 101927200 LOC101927200 uncharacterized LOC101927200 XR_936741.2 1.7% (many diffs)
193 human 203197 TMEM268 transmembrane protein 268 XR_001746226.1 1.7% (many diffs)
194 human 388591 RNF207 ring finger protein 207 XR_001737162.2 1.7% (many diffs)
195 human 102724895 LIVAR liver cell viability associ... NR_146458.1 1.6% 0_1ins42;3T>C;31_1675del
196 human 100127967 KRT73-AS1 KRT73 antisense RNA 1 NR_126005.1 1.6% (many diffs)
197 human 101929634 LINC02280 long intergenic non-protein... NR_135293.1 1.6% (many diffs)
198 human 100873065 PTCHD1-AS PTCHD1 antisense RNA (head ... NR_073010.2 1.6% (many diffs)
199 human 50809 HP1BP3 heterochromatin protein 1 b... XR_001737207.1 1.6% (many diffs)
200 human 23639 LRRC6 leucine rich repeat contain... NR_135911.2 1.6% (many diffs)
201 human 399726 MIR1915HG MIR1915 host gene NR_160800.1 1.6% (many diffs)
202 human 79968 WDR76 WD repeat domain 76 XR_001751398.2 1.6% (many diffs)
203 human 101928004 LOC101928004 uncharacterized LOC101928004 XR_001743948.1 1.6% (many diffs)
204 human 100289019 SLC25A25-AS1 SLC25A25 antisense RNA 1 NR_033374.1 1.6% (many diffs)
205 human 55626 AMBRA1 autophagy and beclin 1 regu... NM_001267782.2 1.6% 1.5% (many diffs)
206 human 9617 MTRF1 mitochondrial translation r... XR_001749742.2 1.6% (many diffs)
207 human 203197 TMEM268 transmembrane protein 268 XR_001746225.1 1.6% (many diffs)
208 human 1677 DFFB DNA fragmentation factor su... XR_001737011.2 1.6% (many diffs)
209 human 105375936 LOC105375936 uncharacterized LOC105375936 XR_929125.2 1.6% (many diffs)
210 human 8795 TNFRSF10B TNF receptor superfamily me... NR_027140.2 1.6% (many diffs)
211 human 83858 ATAD3B ATPase family AAA domain co... XR_001737469.1 1.6% (many diffs)
212 human 728558 ENTPD1-AS1 ENTPD1 antisense RNA 1 NR_038444.1 1.5% (many diffs)
213 human 105373582 LOC105373582 uncharacterized LOC105373582 XR_923257.3 1.5% (many diffs)
214 human 101928004 LOC101928004 uncharacterized LOC101928004 XR_001743947.1 1.5% (many diffs)
215 human 388591 RNF207 ring finger protein 207 XR_946652.3 1.5% (many diffs)
216 human 388591 RNF207 ring finger protein 207 XR_946651.3 1.5% (many diffs)
217 human 102723539 LOC102723539 uncharacterized LOC102723539 XR_001748173.1 1.5% (many diffs)
218 human 23639 LRRC6 leucine rich repeat contain... NR_135913.2 1.5% (many diffs)
219 human 101928004 LOC101928004 uncharacterized LOC101928004 XR_001743944.1 1.5% (many diffs)
220 human 388591 RNF207 ring finger protein 207 XR_001737159.2 1.5% (many diffs)
221 human 64766 S100PBP S100P binding protein NR_135107.1 1.5% (many diffs)
222 human 6773 STAT2 signal transducer and activ... XR_001748858.2 1.5% (many diffs)
223 human 54737 MPHOSPH8 M-phase phosphoprotein 8 XR_002957453.1 1.5% (many diffs)
224 human 64766 S100PBP S100P binding protein NR_135106.1 1.5% (many diffs)
225 human 6773 STAT2 signal transducer and activ... XR_001748856.1 1.5% (many diffs)
226 human 54737 MPHOSPH8 M-phase phosphoprotein 8 XR_001749585.2 1.5% (many diffs)
227 human 101928004 LOC101928004 uncharacterized LOC101928004 XR_926424.2 1.5% (many diffs)
228 human 101929390 LINC01247 long intergenic non-protein... NR_110251.1 1.4% (many diffs)
229 human 64766 S100PBP S100P binding protein XR_946740.3 1.4% (many diffs)
230 human 6773 STAT2 signal transducer and activ... XR_001748857.1 1.4% (many diffs)
231 human 64766 S100PBP S100P binding protein XR_001737364.2 1.4% (many diffs)
232 human 388591 RNF207 ring finger protein 207 XR_001737158.2 1.4% (many diffs)
233 human 200316 APOBEC3F apolipoprotein B mRNA editi... XR_002958675.1 1.4% (many diffs)
234 human 64766 S100PBP S100P binding protein XR_001737363.2 1.4% (many diffs)
235 human 105371767 LOC105371767 uncharacterized LOC105371767 XR_934741.2 1.4% (many diffs)
236 human 105372309 LOC105372309 uncharacterized LOC105372309 XR_936387.1 1.4% (many diffs)
237 human 30835 CD209 CD209 molecule NR_026692.2 1.4% (many diffs)
238 human 54944 LINC01521 long intergenic non-protein... NR_120386.1 1.4% (many diffs)
239 human 54737 MPHOSPH8 M-phase phosphoprotein 8 XR_001749584.2 1.4% (many diffs)
240 human 23639 LRRC6 leucine rich repeat contain... NR_135912.2 1.4% (many diffs)
241 human 105369325 LOC105369325 uncharacterized LOC105369325 XR_950153.2 1.4% (many diffs)
242 human 100130027 LOC100130027 uncharacterized LOC100130027 NR_147501.1 1.4% (many diffs)
243 human 347862 GATD1 glutamine amidotransferase ... NR_134867.2 1.4% (many diffs)
244 human 50809 HP1BP3 heterochromatin protein 1 b... XR_001737206.2 1.4% (many diffs)
245 human 101928004 LOC101928004 uncharacterized LOC101928004 XR_001743942.1 1.4% (many diffs)
246 human 347862 GATD1 glutamine amidotransferase ... NR_134868.2 1.4% (many diffs)
247 human 6773 STAT2 signal transducer and activ... XR_002957376.1 1.4% (many diffs)
248 human 347862 GATD1 glutamine amidotransferase ... XR_242802.3 1.4% (many diffs)
249 human 105379383 LOC105379383 uncharacterized LOC105379383 XR_949689.3 1.4% (many diffs)
250 human 8837 CFLAR CASP8 and FADD like apoptos... XR_001739016.2 1.4% (many diffs)
251 human 54737 MPHOSPH8 M-phase phosphoprotein 8 XR_001749586.2 1.4% (many diffs)
252 human 6773 STAT2 signal transducer and activ... XR_002957375.1 1.3% (many diffs)
253 human 6556 SLC11A1 solute carrier family 11 me... XR_427107.3 1.3% (many diffs)
254 human 7297 TYK2 tyrosine kinase 2 XR_001753751.1 1.3% (many diffs)
255 human 105370121 LOC105370121 uncharacterized LOC105370121 XR_941763.2 1.3% (many diffs)
256 human 55722 CEP72 centrosomal protein 72 XR_001742146.1 1.3% (many diffs)
257 human 3903 LAIR1 leukocyte associated immuno... NR_110279.3 1.3% (many diffs)
258 human 51754 TMEM8B transmembrane protein 8B XR_002956793.1 1.3% (many diffs)
259 human 101928004 LOC101928004 uncharacterized LOC101928004 XR_926420.2 1.3% (many diffs)
260 human 388591 RNF207 ring finger protein 207 XR_001737164.2 1.3% (many diffs)
261 human 64769 MEAF6 MYST/Esa1 associated factor 6 NR_073091.2 1.3% (many diffs)
262 human 64769 MEAF6 MYST/Esa1 associated factor 6 NR_073090.2 1.3% (many diffs)
263 human 64769 MEAF6 MYST/Esa1 associated factor 6 NR_073092.2 1.3% (many diffs)
264 human 9609 RAB36 RAB36, member RAS oncogene ... NR_146295.2 1.3% (many diffs)
265 human 6556 SLC11A1 solute carrier family 11 me... XR_427108.4 1.3% (many diffs)
266 human 79876 UBA5 ubiquitin like modifier act... XR_001740272.1 1.2% (many diffs)
267 human 91433 RCCD1 RCC1 domain containing 1 XR_001751415.1 1.2% (many diffs)
268 human 91433 RCCD1 RCC1 domain containing 1 XR_001751417.1 1.2% (many diffs)
269 human 9609 RAB36 RAB36, member RAS oncogene ... XR_001755384.1 1.2% (many diffs)
270 human 101926996 RUNDC3A-AS1 RUNDC3A antisense RNA 1 NR_110802.1 1.2% (many diffs)
271 human 2521 FUS FUS RNA binding protein NR_028388.2 1.2% (many diffs)
272 human 4808 NHLH2 nescient helix-loop-helix 2 XR_946659.3 1.2% (many diffs)
273 human 91433 RCCD1 RCC1 domain containing 1 XR_001751414.1 1.2% (many diffs)
274 human 3903 LAIR1 leukocyte associated immuno... NR_110280.3 1.2% (many diffs)
275 human 107987261 LOC107987261 uncharacterized LOC107987261 XR_001753508.2 1.2% (many diffs)
276 human 9609 RAB36 RAB36, member RAS oncogene ... XR_001755383.1 1.2% (many diffs)
277 human 91433 RCCD1 RCC1 domain containing 1 XR_001751416.1 1.2% (many diffs)
278 human 9609 RAB36 RAB36, member RAS oncogene ... XR_001755386.1 1.2% (many diffs)
279 human 9609 RAB36 RAB36, member RAS oncogene ... XR_001755387.1 1.2% (many diffs)
280 human 113201 CASC4 cancer susceptibility 4 NR_157849.2 1.2% (many diffs)
281 human 9609 RAB36 RAB36, member RAS oncogene ... XR_001755381.2 1.2% (many diffs)
282 human 6491 STIL STIL centriolar assembly pr... XR_001737370.1 1.2% (many diffs)
283 human 55858 TMEM165 transmembrane protein 165 XR_001741287.2 1.2% (many diffs)
284 human 92105 INTS4 integrator complex subunit 4 XR_002957208.1 1.2% (many diffs)
285 human 51754 TMEM8B transmembrane protein 8B XR_001746322.1 1.2% (many diffs)
286 human 9609 RAB36 RAB36, member RAS oncogene ... XR_001755380.2 1.2% (many diffs)
287 human 107987299 LOC107987299 uncharacterized LOC107987299 XR_002958640.1 1.2% (many diffs)
288 human 824 CAPN2 calpain 2 XR_002957688.1 1.2% (many diffs)
289 human 79801 SHCBP1 SHC binding and spindle ass... NR_136738.2 1.1% (many diffs)
290 human 7297 TYK2 tyrosine kinase 2 XR_002958353.1 1.1% (many diffs)
291 human 11098 PRSS23 serine protease 23 NR_120593.2 1.1% (many diffs)
292 human 54617 INO80 INO80 complex ATPase subunit XR_001751322.2 1.1% (many diffs)
293 human 101927612 RNF139-AS1 RNF139 antisense RNA 1 (hea... NR_108047.1 1.1% (many diffs)
294 human 105370276 LOC105370276 uncharacterized LOC105370276 XR_001749938.2 1.1% (many diffs)
295 human 107986428 LOC107986428 uncharacterized LOC107986428 XR_001742760.1 1.1% (many diffs)
296 human 89932 PAPLN papilin, proteoglycan like ... NR_158677.2 1.1% (many diffs)
297 human 114819 CROCCP3 CROCC pseudogene 3 NR_023386.1 1.1% (many diffs)
298 human 80143 SIKE1 suppressor of IKBKE 1 NR_049742.2 1.1% (many diffs)
299 human 105373218 LOC105373218 uncharacterized LOC105373218 XR_001738550.1 1.1% (many diffs)
300 human 89932 PAPLN papilin, proteoglycan like ... NR_158678.2 1.1% (many diffs)
301 human 100132815 IPO5P1 importin 5 pseudogene 1 NR_103742.1 1.1% (many diffs)
302 human 107986428 LOC107986428 uncharacterized LOC107986428 XR_001742759.1 1.1% (many diffs)
303 human 101928004 LOC101928004 uncharacterized LOC101928004 XR_926425.3 1.1% (many diffs)
304 human 100132815 IPO5P1 importin 5 pseudogene 1 NR_103741.1 1.1% (many diffs)
305 human 80143 SIKE1 suppressor of IKBKE 1 NR_049741.2 1.1% (many diffs)
306 human 64743 WDR13 WD repeat domain 13 NR_029427.3 1.1% (many diffs)
307 human 379013 RNF138P1 ring finger protein 138 pse... NR_001575.1 1.1% (many diffs)
308 human 105376447 LOC105376447 uncharacterized LOC105376447 XR_001747390.2 1.1% (many diffs)
309 human 4336 MOBP myelin associated oligodend... NR_003090.3 1.1% (many diffs)
310 human 4771 NF2 neurofibromin 2 NR_156186.2 1.1% (many diffs)
311 human 107987299 LOC107987299 uncharacterized LOC107987299 XR_001755068.2 1% (many diffs)
312 human 100533970 P2RX5-TAX1BP3 P2RX5-TAX1BP3 readthrough (... NR_037928.1 1% (many diffs)
313 human 56922 MCCC1 methylcrotonoyl-CoA carboxy... XR_002959553.1 1% (many diffs)
314 human 100128164 LOC100128164 four and a half LIM domains... NR_027622.1 1% (many diffs)
315 human 4336 MOBP myelin associated oligodend... NR_103504.2 1% (many diffs)
316 human 8837 CFLAR CASP8 and FADD like apoptos... XR_001739018.1 1% (many diffs)
317 human 101928045 LOC101928045 uncharacterized LOC101928045 XR_001752980.2 1% (many diffs)
318 human 4336 MOBP myelin associated oligodend... NR_103505.2 1% (many diffs)
319 human 94056 SYAP1 synapse associated protein 1 NR_033181.2 1% (many diffs)
320 human 107986813 LOC107986813 uncharacterized LOC107986813 XR_001745254.1 1% (many diffs)
321 human 11322 TMC6 transmembrane channel like 6 XR_001752420.1 1% (many diffs)
322 human 23341 DNAJC16 DnaJ heat shock protein fam... NR_109898.2 1% (many diffs)
323 human 105376447 LOC105376447 uncharacterized LOC105376447 XR_001747389.2 .9% (many diffs)
324 human 23241 PACS2 phosphofurin acidic cluster... XR_001750200.2 .9% (many diffs)
325 human 197358 NLRC3 NLR family CARD domain cont... NR_075083.3 .9% (many diffs)
326 human 23431 AP4E1 adaptor related protein com... XR_001751183.1 .9% (many diffs)
327 human 84144 SYDE2 synapse defective Rho GTPas... XR_002957773.1 .9% (many diffs)
328 human 105371622 LOC105371622 uncharacterized LOC105371622 XR_922296.3 .9% (many diffs)
329 human 6646 SOAT1 sterol O-acyltransferase 1 NR_045530.2 .9% (many diffs)
330 human 55892 MYNN myoneurin NR_033702.2 .9% (many diffs)
331 human 55892 MYNN myoneurin NR_033703.2 .9% (many diffs)
332 human 80975 TMPRSS5 transmembrane serine protea... XR_001747992.1 .9% (many diffs)
333 human 105372840 LINC01694 long intergenic non-protein... NR_146912.1 .9% (many diffs)
334 human 80975 TMPRSS5 transmembrane serine protea... XR_001747991.1 .9% (many diffs)
335 human 57475 PLEKHH1 pleckstrin homology, MyTH4 ... XR_001750461.1 .9% (many diffs)
336 human 105371271 LOC105371271 uncharacterized LOC105371271 XR_933590.2 .9% (many diffs)
337 human 80975 TMPRSS5 transmembrane serine protea... XR_001747990.1 .9% (many diffs)
338 human 105372268 LOC105372268 uncharacterized LOC105372268 XR_001753862.1 .9% (many diffs)
339 human 105372579 LOC105372579 uncharacterized LOC105372579 XR_001754564.2 .9% (many diffs)
340 human 57475 PLEKHH1 pleckstrin homology, MyTH4 ... XR_001750460.1 .9% (many diffs)
341 human 7799 PRDM2 PR/SET domain 2 XR_002957562.1 .9% (many diffs)
342 human 54928 IMPAD1 inositol monophosphatase do... XR_928786.2 .8% (many diffs)
343 human 105371241 LOC105371241 uncharacterized LOC105371241 XR_001752138.2 .8% (many diffs)
344 human 84248 FYTTD1 forty-two-three domain cont... NR_027840.2 .8% (many diffs)
345 human 105376239 LOC105376239 uncharacterized LOC105376239 XR_930276.3 .8% (many diffs)
346 human 23341 DNAJC16 DnaJ heat shock protein fam... XR_001737079.2 .8% (many diffs)
347 human 55320 MIS18BP1 MIS18 binding protein 1 XR_001750406.2 .8% (many diffs)
348 human 160428 ALDH1L2 aldehyde dehydrogenase 1 fa... NR_027752.2 .8% (many diffs)
349 human 107986015 LOC107986015 uncharacterized LOC107986015 XR_001740433.2 .8% (many diffs)
350 human 200014 CC2D1B coiled-coil and C2 domain c... XR_001737028.1 .8% (many diffs)
351 human 57475 PLEKHH1 pleckstrin homology, MyTH4 ... XR_002957564.1 .8% (many diffs)
352 human 105371441 LOC105371441 uncharacterized LOC105371441 XR_001738234.1 .8% (many diffs)
353 human 200014 CC2D1B coiled-coil and C2 domain c... XR_001737027.1 .8% (many diffs)
354 human 26235 FBXL4 F-box and leucine rich repe... NR_103836.2 .8% (many diffs)
355 human 55666 NPLOC4 NPL4 homolog, ubiquitin rec... XR_001752557.1 .8% (many diffs)
356 human 105371441 LOC105371441 uncharacterized LOC105371441 XR_922141.2 .8% (many diffs)
357 human 8837 CFLAR CASP8 and FADD like apoptos... NR_147242.2 .8% (many diffs)
358 human 6642 SNX1 sorting nexin 1 XR_001751381.1 .8% (many diffs)
359 human 134492 NUDCD2 NudC domain containing 2 NR_138427.2 .7% (many diffs)
360 human 114004397 CA5BP1-CA5B CA5BP1-CA5B readthrough NR_160544.1 .7% (many diffs)
361 human 11279 KLF8 Kruppel like factor 8 NR_136704.1 .7% (many diffs)
362 human 200014 CC2D1B coiled-coil and C2 domain c... XR_002959657.1 .7% (many diffs)
363 human 134492 NUDCD2 NudC domain containing 2 NR_138426.2 .7% (many diffs)
364 human 105379504 LOC105379504 uncharacterized LOC105379504 XR_001754936.1 .7% (many diffs)
365 human 105372793 LOC105372793 uncharacterized LOC105372793 XR_001755014.1 .7% (many diffs)
366 human 55729 ATF7IP activating transcription fa... XR_001748808.2 .7% (many diffs)
367 human 144699 FBXL14 F-box and leucine rich repe... XR_001748600.2 .7% (many diffs)
368 human 5939 RBMS2 RNA binding motif single st... XR_002957368.1 .7% (many diffs)
369 human 112268420 LOC112268420 uncharacterized LOC112268420 XR_002959408.1 .7% (many diffs)
370 human 55131 RBM28 RNA binding motif protein 28 XR_001744830.1 .7% (many diffs)
371 human 9687 GREB1 growth regulating estrogen ... XR_001739081.2 .7% (many diffs)
372 human 101928387 LOC101928387 uncharacterized LOC101928387 XR_001749034.2 .7% (many diffs)
373 human 84515 MCM8 minichromosome maintenance ... XR_001754423.1 .6% (many diffs)
374 human 84515 MCM8 minichromosome maintenance ... XR_001754422.1 .6% (many diffs)
375 human 107984791 LOC107984791 uncharacterized LOC107984791 XR_001751595.1 .6% 0_1ins41;16A>G;32_4637del
376 human 92399 MRRF mitochondrial ribosome recy... NR_144421.2 .6% (many diffs)
377 human 112267989 LOC112267989 uncharacterized LOC112267989 XR_002956527.1 .6% (many diffs)
378 human 112267989 LOC112267989 uncharacterized LOC112267989 XR_002959037.1 .6% (many diffs)
379 human 4043 LRPAP1 LDL receptor related protei... NR_110005.1 .6% (many diffs)
380 human 9063 PIAS2 protein inhibitor of activa... NR_136684.2 .5% (many diffs)
381 human 9063 PIAS2 protein inhibitor of activa... NR_148702.2 .5% (many diffs)
382 human 57506 MAVS mitochondrial antiviral sig... NR_037921.2 .5% (many diffs)
383 human 9063 PIAS2 protein inhibitor of activa... NR_148700.2 .5% (many diffs)
384 human 9063 PIAS2 protein inhibitor of activa... NR_148701.2 .5% (many diffs)
385 human 9063 PIAS2 protein inhibitor of activa... NR_148703.2 .5% (many diffs)
386 human 9194 SLC16A7 solute carrier family 16 me... NR_073056.2 .5% (many diffs)
387 human 753 LDLRAD4 low density lipoprotein rec... XR_001753270.1 .5% (many diffs)
388 human 9194 SLC16A7 solute carrier family 16 me... NR_073055.2 .5% (many diffs)
389 human 753 LDLRAD4 low density lipoprotein rec... XR_001753271.1 .5% (many diffs)
390 human 80012 PHC3 polyhomeotic homolog 3 XR_001740274.2 .5% (many diffs)
391 human 80012 PHC3 polyhomeotic homolog 3 XR_001740275.2 .5% (many diffs)
392 human 11279 KLF8 Kruppel like factor 8 NR_136705.1 .5% (many diffs)
393 human 285220 EPHA6 EPH receptor A6 XR_001740110.1 .4% (many diffs)
394 human 107986016 LOC107986016 uncharacterized LOC107986016 XR_001740435.1 .4% (many diffs)
395 human 6391 SDHC succinate dehydrogenase com... NR_103459.2 .4% (many diffs)
396 human 753 LDLRAD4 low density lipoprotein rec... XR_001753269.1 .4% (many diffs)
397 human 753 LDLRAD4 low density lipoprotein rec... XR_001753268.1 .4% (many diffs)
398 human 3824 KLRD1 killer cell lectin like rec... NR_147040.2 .4% (many diffs)
399 human 3824 KLRD1 killer cell lectin like rec... NR_147039.2 .4% (many diffs)
400 human 3824 KLRD1 killer cell lectin like rec... NR_147038.2 .4% (many diffs)
401 human 28977 MRPL42 mitochondrial ribosomal pro... NR_038160.2 .4% (many diffs)
402 human 28977 MRPL42 mitochondrial ribosomal pro... NR_038159.2 .4% (many diffs)
403 human 28977 MRPL42 mitochondrial ribosomal pro... NR_038161.2 .4% (many diffs)
404 human 753 LDLRAD4 low density lipoprotein rec... XR_001753267.1 .4% (many diffs)
405 human 55508 SLC35E3 solute carrier family 35 me... NR_149144.3 .3% (many diffs)
406 human 55508 SLC35E3 solute carrier family 35 me... NR_149143.3 .3% (many diffs)
407 human 100131257 LOC100131257 zinc finger protein 655 pse... NR_034022.1 .2% (many diffs)
Download CSV

Sequence Information

Note: uppercase bases indicate empirically verified sequence.

ORF start:
317
ORF end:
389
ORF length:
72
Sequence:
1GTCGCTTCAT GTGACTCCAC GGAGTACCGG GCGCCGTCCA GGCACCTCGA TTAGTTCTCG
61AGCTTTTGGA GTACGTCGTC TTTAGGTTGG GGGGAGGGGT TTTATGCGAT GGAGTTTCCC
121CACACTGAGT GGGTGGAGAC TGAAGTTAGG CCAGCTTGGC ACTTGATGTA ATTCTCCTTG
181GAATTTGCCC TTTTTGAGTT TGGATCTTGG TTCATTCTCA AGCCTCAGAC AGTGGTTCAA
241AGTTTTTTTC TTCCATTTCA GGTGTCGTGA GGCTAGCATC GATTGATCAA CAAGTTTGTA
301CAAAAAAGTT GGCACCATGG GGTTTCTCCA TGTCGGTCAG GCTGGTCTGG AACTCCTGAC
361CTCAGGTGAT CCGCCCACCT CAGCCTCCTT GCCAACTTTC TTGTACAAAG TGGTTGATAT
421CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC
481GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGATTATAG
541GCCCAGAGCA CTACCAACAC GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt
601gaaagatt

Download FASTA (ORF) (Full)

GPP Web Portal Terms of Service

Effective Date: December 8, 2025
By using this site, you agree to our terms and conditions below.

Overview of Terms

The data made available on this website were generated for research purposes and are not intended for clinical or commercial uses. Commercial use (or other use for profit-making purposes) of the GPP Web Portal and its tools, is not permitted under these terms and may require a separate license agreement from Broad or its contributors. For more information, please contact partnering@broadinstitute.org.

The original data may be subject to rights claimed by third parties, including but not limited to, patent, copyright, other intellectual property rights, biodiversity-related access and benefit-sharing rights. It is the responsibility of users of Broad Institute services to ensure that their use of the data does not infringe any of the rights of such third parties.

Any questions or comments concerning these Terms of Use can be addressed to: legal@broadinstitute.org.

By accessing and viewing this GPP Web Portal, you agree to the following terms and conditions:

Attribution

You agree to acknowledge the Broad Institute (e.g., in publications, services or products) for any of your use of its online services, databases or software in accordance with good scientific practice. You agree to use the acknowledgment wording provided for the relevant tools as indicated on the FAQ for each tool.

Updating the Terms of Use

We reserve the right to update these Terms of Use at any time. When alterations are inevitable, we will attempt to give reasonable notice of any changes by placing a notice on our website, but you may wish to check each time you use the website. The date of the most recent revision will appear on this, the "GPP Web Portal Terms of Use" page. If you do not agree to these changes, please do not continue to use our online services. We will also make available an archived copy of the previous Terms of Use for comparison.

Indemnification and Disclaimer of Warranties

You are using this GPP Web Portal at your own risk, and you hereby agree to hold Broad and its contributors and their trustees, directors, officers, employees, and affiliated investigators harmless for any third party claims which may arise from your use of the GPP Web Portal, the tools available therein, or any portion thereof. Further, you agree to indemnify Broad, its contributors, and its and their trustees, directors, officers, employees, affiliated investigators, students, and affiliates for any loss, costs, claims, damages, or other liabilities arising from any unpermitted commercial or profit-making use you make of the GPP Web Portal. The GPP Web Portal is a research tool and is provided "as is". Broad does not represent that the GPP Web Portal is free of errors or bugs or suitable for any particular tasks.

ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS ARE DISCLAIMED. IN NO EVENT SHALL BROAD OR ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THE GPP WEB PORTAL, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.

Governing Law

The terms and conditions herein shall be construed, governed, interpreted, and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A. Furthermore, by accessing, downloading, or using the Database, You consent to the personal jurisdiction of, and venue in, the state and federal courts within Massachusetts with respect to Your download or use of the Database.