Transcript: Human NR_027642.1

Homo sapiens DDB1 and CUL4 associated factor 13 pseudogene 3 (DCAF13P3), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
DCAF13P3 (100132724)
Length:
2445
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027642.1
NBCI Gene record:
DCAF13P3 (100132724)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027642.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339435 GTGGACAGCAAGTAGACATTT pLKO_005 1053 3UTR 100% 13.200 6.600 Y Dcaf13 n/a
2 TRCN0000137754 GCCTGTGGAAAGCTAATGCTT pLKO.1 1582 3UTR 100% 3.000 1.500 Y DCAF13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027642.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14096 pDONR223 100% 51.1% None (many diffs) n/a
2 ccsbBroad304_14096 pLX_304 0% 51.1% V5 (many diffs) n/a
Download CSV