Transcript: Mouse NR_027858.1

Mus musculus NLR family, pyrin domain containing 1C, pseudogene (Nlrp1c-ps), non-coding RNA.

Source:
NCBI, updated 2017-05-07
Taxon:
Mus musculus (mouse)
Gene:
Nlrp1c-ps (627984)
Length:
3457
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027858.1
NBCI Gene record:
Nlrp1c-ps (627984)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_027858.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255097 AGGCTCAATTGGTCGTAATAG pLKO_005 270 3UTR 100% 13.200 18.480 N Nlrp1c-ps n/a
2 TRCN0000255100 CAATAATGCATGGACTAATAA pLKO_005 1518 3UTR 100% 15.000 10.500 N Nlrp1c-ps n/a
3 TRCN0000255098 TTGCTGCATTTAGATTGATTA pLKO_005 795 3UTR 100% 13.200 9.240 N Nlrp1c-ps n/a
4 TRCN0000255099 ATGGACCAGGGTAGAGTAATC pLKO_005 893 3UTR 100% 10.800 7.560 N Nlrp1c-ps n/a
5 TRCN0000267517 GCCATGGCCATTGATGATGAA pLKO_005 2846 3UTR 100% 4.950 3.465 N Nlrp1c-ps n/a
6 TRCN0000037673 GCTACAAATCAAAGACAAGAA pLKO.1 3061 3UTR 100% 4.950 2.970 N HK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027858.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.