Transcript: Human NR_027916.2

Homo sapiens aldo-keto reductase family 1 member C8, pseudogene (AKR1C8P), non-coding RNA.

Source:
NCBI, updated 2018-06-03
Taxon:
Homo sapiens (human)
Gene:
AKR1C8P (340811)
Length:
2182
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027916.2
NBCI Gene record:
AKR1C8P (340811)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027916.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046546 GCACTTATGCTCCTGATCATA pLKO.1 157 3UTR 100% 5.625 7.875 N AKR1C8P n/a
2 TRCN0000046545 GAGCCGATCTTGAAATCCATT pLKO.1 750 3UTR 100% 4.950 3.960 N AKR1C8P n/a
3 TRCN0000046544 CCATATTGATTCAGCATACTT pLKO.1 233 3UTR 100% 5.625 3.938 N AKR1C8P n/a
4 TRCN0000046543 GCTACTTTCTTTCGGGCAGAA pLKO.1 351 3UTR 100% 4.050 2.835 N AKR1C8P n/a
5 TRCN0000046547 CTGGGAAAGAATTACTGCCAA pLKO.1 519 3UTR 100% 2.640 1.584 N AKR1C8P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027916.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10358 pDONR223 100% 17.7% None 1_83del;471_2182del n/a
2 ccsbBroad304_10358 pLX_304 0% 17.7% V5 1_83del;471_2182del n/a
Download CSV