Transcript: Human NR_028139.1

Homo sapiens spermatogenesis associated 41 (SPATA41), transcript variant 1, long non-coding RNA.

Source:
NCBI, updated 2018-05-18
Taxon:
Homo sapiens (human)
Gene:
SPATA41 (388182)
Length:
3176
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028139.1
NBCI Gene record:
SPATA41 (388182)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_028139.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129800 CGACAACAATTATCACAGTGA pLKO.1 1289 3UTR 100% 2.640 3.696 N SPATA41 n/a
2 TRCN0000022340 CGCGGAATTTGAGGCTGGAAT pLKO.1 764 3UTR 100% 4.950 3.960 N LOC145760 n/a
3 TRCN0000128538 CTCAACAGGAAAGTAGTGAAA pLKO.1 790 3UTR 100% 4.950 3.465 N SPATA41 n/a
4 TRCN0000022339 CTCAGTCCTCTATCTGTGAAA pLKO.1 1628 3UTR 100% 4.950 3.465 N LOC145760 n/a
5 TRCN0000022342 TGCTGTGTGTGAAGCACTCAA pLKO.1 1334 3UTR 100% 4.950 3.465 N LOC145760 n/a
6 TRCN0000129609 CTCAGAAAGACACTGCCTGTA pLKO.1 1558 3UTR 100% 4.050 2.835 N SPATA41 n/a
7 TRCN0000022343 GAGGCTGGAATCCAAGCTCAA pLKO.1 774 3UTR 100% 4.050 2.835 N LOC145760 n/a
8 TRCN0000130848 GCTTTGTCTATCTCAAGGGTA pLKO.1 1463 3UTR 100% 2.640 1.848 N SPATA41 n/a
9 TRCN0000127591 CAATTATCACAGTGACGGTGA pLKO.1 1295 3UTR 100% 2.160 1.512 N SPATA41 n/a
10 TRCN0000022341 CCCACAGAGAGTGGTTGGCAA pLKO.1 711 3UTR 100% 0.880 0.528 N LOC145760 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028139.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.