Transcript: Human NR_028324.1

Homo sapiens long intergenic non-protein coding RNA 1002 (LINC01002), long non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
LINC01002 (399844)
Length:
4874
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028324.1
NBCI Gene record:
LINC01002 (399844)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_028324.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000202692 CTTGGCCTCTAATTTGTTTAT pLKO.1 4767 3UTR 100% 13.200 6.600 Y LINC01002 n/a
2 TRCN0000188863 GCACAGCTCCATCGTTACAAT pLKO.1 381 3UTR 100% 5.625 2.813 Y LOC401357 n/a
3 TRCN0000187321 CAGCAAGTAAGCAAGCTCTTT pLKO.1 1135 3UTR 100% 4.950 2.475 Y LINC01002 n/a
4 TRCN0000204496 CTGCCTCTCAACAACCTCTTT pLKO.1 872 3UTR 100% 4.950 2.475 Y LINC01002 n/a
5 TRCN0000204513 CCAGCAAGTAAGCAAGCTCTT pLKO.1 1134 3UTR 100% 4.050 2.025 Y LINC01002 n/a
6 TRCN0000082593 CCATCGTTACAATGGCCTCTT pLKO.1 389 3UTR 100% 4.050 2.025 Y LOC442558 n/a
7 TRCN0000188825 CTGAAGAGCTTGGTTGCAGAA pLKO.1 3751 3UTR 100% 4.050 2.025 Y LINC01002 n/a
8 TRCN0000204287 CCCTGAACTTTCTCAAGTCGA pLKO.1 446 3UTR 100% 2.640 1.320 Y LOC401357 n/a
9 TRCN0000188484 CAATGGCCTATTTAGGCCCAT pLKO.1 302 3UTR 100% 0.216 0.108 Y LOC401357 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028324.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.