Transcript: Human NR_028475.1

Homo sapiens solute carrier family 25 member 26 (SLC25A26), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
SLC25A26 (115286)
Length:
2239
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028475.1
NBCI Gene record:
SLC25A26 (115286)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_028475.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044154 CAAGGGTTGTATCGAGGCTAT pLKO.1 608 3UTR 100% 4.050 5.670 N SLC25A26 n/a
2 TRCN0000044153 GACAAGAATTACGCTGGCAAA pLKO.1 893 3UTR 100% 4.050 5.670 N SLC25A26 n/a
3 TRCN0000412986 GCTGATTCATCTTCATATTTG pLKO_005 434 3UTR 100% 13.200 9.240 N SLC25A26 n/a
4 TRCN0000044155 CACAGGTATCTGCTTCTACAA pLKO.1 543 3UTR 100% 4.950 3.465 N SLC25A26 n/a
5 TRCN0000422412 CCATCAGTCTGGGAGGTTTCA pLKO_005 1021 3UTR 100% 4.950 3.465 N SLC25A26 n/a
6 TRCN0000044156 GCTGTTGGAAGTTGGCAGAAA pLKO.1 1076 3UTR 100% 4.950 3.465 N SLC25A26 n/a
7 TRCN0000421363 GGATCATGTGGTGGATTCTTG pLKO_005 800 3UTR 100% 4.950 3.465 N SLC25A26 n/a
8 TRCN0000422336 GTCAGCAGTCTGTGGAGCTTT pLKO_005 824 3UTR 100% 4.950 3.465 N SLC25A26 n/a
9 TRCN0000044157 GTTTCCCTTATGGGAGTCCTT pLKO.1 755 3UTR 100% 2.640 1.848 N SLC25A26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028475.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.