Transcript: Human NR_028503.1

Homo sapiens MIR22 host gene (MIR22HG), transcript variant 2, long non-coding RNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
MIR22HG (84981)
Length:
1852
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028503.1
NBCI Gene record:
MIR22HG (84981)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_028503.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172678 GCCTCCATGTCATTTGACCTA pLKO.1 1332 3UTR 100% 2.640 3.696 N MIR22HG n/a
2 TRCN0000167255 CCTTAGCAAACCATAACAGAA pLKO.1 1185 3UTR 100% 4.950 3.465 N MIR22HG n/a
3 TRCN0000172652 GATTAGAGACACTGGCTGGAT pLKO.1 406 3UTR 100% 2.640 1.848 N MIR22HG n/a
4 TRCN0000167695 GTGCATGTTATGTGATTTCAA pLKO.1 1635 3UTR 100% 5.625 3.375 N MIR22HG n/a
5 TRCN0000172750 CGAAAGGACACACACAGGAAA pLKO.1 1072 3UTR 100% 4.950 2.970 N MIR22HG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028503.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10529 pDONR223 100% 8.6% None (many diffs) n/a
2 ccsbBroad304_10529 pLX_304 0% 8.6% V5 (many diffs) n/a
Download CSV