Transcript: Human NR_033302.2

Homo sapiens DExH-box helicase 9 (DHX9), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
DHX9 (1660)
Length:
4630
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033302.2
NBCI Gene record:
DHX9 (1660)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033302.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314575 ACGACAATGGAAGCGGATATA pLKO_005 3769 3UTR 100% 13.200 18.480 N DHX9 n/a
2 TRCN0000001208 GGCTTTCGTTTAATACAATAG pLKO.1 4356 3UTR 100% 10.800 15.120 N DHX9 n/a
3 TRCN0000071116 CGCAAAGTGTTTGATCCAGTA pLKO.1 2355 3UTR 100% 4.050 5.670 N Dhx9 n/a
4 TRCN0000350304 GGGCTATATCCATCGAAATTT pLKO_005 2969 3UTR 100% 15.000 12.000 N DHX9 n/a
5 TRCN0000314518 TCGTCCTCATGCCAGTATAAT pLKO_005 1709 3UTR 100% 15.000 10.500 N DHX9 n/a
6 TRCN0000314517 TTAAGGAAACCAAGCATATAG pLKO_005 4218 3UTR 100% 13.200 9.240 N DHX9 n/a
7 TRCN0000001210 GAAGGATTACTACTCAAGAAA pLKO.1 567 3UTR 100% 5.625 3.938 N DHX9 n/a
8 TRCN0000314516 GAAGGATTACTACTCAAGAAA pLKO_005 567 3UTR 100% 5.625 3.938 N DHX9 n/a
9 TRCN0000071113 GCTGGTATCAACCTTATGATT pLKO.1 3699 3UTR 100% 5.625 3.938 N Dhx9 n/a
10 TRCN0000001211 AGACTTAATATGGCTACACTA pLKO.1 3099 3UTR 100% 4.950 3.465 N DHX9 n/a
11 TRCN0000071117 CCTCCACAATCCAACTGGAAT pLKO.1 1269 3UTR 100% 4.950 3.465 N Dhx9 n/a
12 TRCN0000001209 CCAGAAGAATCAGTGCGGTTT pLKO.1 1603 3UTR 100% 4.050 2.835 N DHX9 n/a
13 TRCN0000001212 TCGAGGAATCAGTCATGTAAT pLKO.1 1775 3UTR 100% 13.200 7.920 N DHX9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033302.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.