Transcript: Mouse NR_033325.1

Mus musculus predicted gene 5089 (Gm5089), transcript variant 1, long non-coding RNA.

Source:
NCBI, updated 2013-11-05
Taxon:
Mus musculus (mouse)
Gene:
Gm5089 (328479)
Length:
2008
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033325.1
NBCI Gene record:
Gm5089 (328479)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_033325.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000269979 GTGTCATGCTTCCAGTAATAC pLKO_005 806 3UTR 100% 13.200 18.480 N Gm5089 n/a
2 TRCN0000270051 TACAATACCAGGCAATCAATT pLKO_005 761 3UTR 100% 13.200 18.480 N Gm5089 n/a
3 TRCN0000217426 GGCAATCAATTGGTAGGTAAG pLKO.1 771 3UTR 100% 6.000 8.400 N Gm5089 n/a
4 TRCN0000270052 CCAACACCATGGCATGATTTA pLKO_005 1799 3UTR 100% 13.200 9.240 N Gm5089 n/a
5 TRCN0000183643 GCACTGAAATTGTGTAGTATA pLKO.1 897 3UTR 100% 13.200 9.240 N Gm5089 n/a
6 TRCN0000269978 TCTGGAAAGAAACACTGATAC pLKO_005 602 3UTR 100% 10.800 7.560 N Gm5089 n/a
7 TRCN0000179664 GCATAGATGCTCTTGATGAGA pLKO.1 676 3UTR 100% 3.000 2.100 N Gm5089 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033325.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.