Transcript: Mouse NR_033602.1

Mus musculus predicted gene 5779 (Gm5779), non-coding RNA.

Source:
NCBI, updated 2013-07-16
Taxon:
Mus musculus (mouse)
Gene:
Gm5779 (544707)
Length:
907
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033602.1
NBCI Gene record:
Gm5779 (544707)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_033602.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033602.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06887 pDONR223 100% 83.1% None (many diffs) n/a
2 ccsbBroad304_06887 pLX_304 0% 83.1% V5 (many diffs) n/a
3 TRCN0000469213 GTCCTAATACCTTTCCTTACCAGA pLX_317 51.3% 83.1% V5 (many diffs) n/a
4 ccsbBroadEn_01441 pDONR223 100% 83.1% None (many diffs) n/a
5 ccsbBroad304_01441 pLX_304 0% 83.1% V5 (many diffs) n/a
6 TRCN0000473471 GGCAACGGAACGTTATTAGGTACT pLX_317 41.1% 83.1% V5 (many diffs) n/a
7 ccsbBroadEn_15575 pDONR223 0% 83% None (many diffs) n/a
8 ccsbBroad304_15575 pLX_304 0% 83% V5 (many diffs) n/a
9 TRCN0000471568 CGTGCTACGAGCTATTCGTACCGT pLX_317 41.1% 83% V5 (many diffs) n/a
Download CSV